back Return to this vector's summary.
ID   IIA        preliminary; circular DNA; SYN; 78 BP.
XX
AC   M60894;
XX
DT   26-MAR-1991 (Rel. 6, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector II-a  - incomplete, Tn5 element O region.
XX
KW   cloning vector; transposon.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-78
RC   I from pBR322 & pBRG1305 & pLS302
RC   II from pBR322 & pBRG1305 & pLS302
RC   I-a from I & pUC4K, kan gene
RC   II-a from II & pUC4K, kan gene
RA   Tomcsanyi T., Berg C.M., Phadnis S.H., Berg D.E.;
RT   "Intramolecular transposition by a synthetic IS50 (Tn5) derivative";
RL   J. Bacteriol. 172:6348-6354(1990).
XX
CC   NCBI gi: 209026
CC   NM (II-a)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA ()
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 PvuII 4361bp 2067..2067
FT                   2. pC194 HpaII-MboI 1030bp 975..2005, cat gene
FT                   -> pJH101 5400bp
FT                   1. pJH101 HindIII 5400bp 30..30
FT                   2. B.subtilis HindIII-HindIII 4900bp, IS1/sacB/sacR
FT                   -> pLS50 10300bp
FT                   1. pLS50 remove Sau3A/MboI-Sau3A/MboI 2500bp,
FT                   \ 3' to sacR to tet
FT                   -> pLS51 7800bp [unique Sau3A/MboI]
FT                   1. pLS51 remove EcoRI-EcoRI 2900bp, IS1/sacB gene
FT                   -> pLS52 4900bp
FT                   1. pUC8 remove EcoRI-BamHI 10bp 231..241, MCS/2655bp
FT                   2. pLS52 Sau3A/MboI-EcoRI, 3' B.subtilis sacB gene
FT                   -> pLS301
FT                   1. pLS301 EcoRI 231..231
FT                   2. pLS51 EcoRI-EcoRI, 5' sacB gene
FT                   -> pLS302
FT                   1. pBR322 PvuII 4361bp 2067..2067
FT                   2. M13, ori
FT                   -> pMOJ7
FT                   1. Tn10, IS50/tet gene
FT                   -> pBRG700
FT                   1. pMOJ7 KpnI-EcoRI, M13 ori/ori/amp gene
FT                   2. pGC1 HindIII-ClaI 300bp
FT                   EcoRI linker:
FT                   EcoRI-ClaI, GC clamp/19bp primer
FT                   3. oligo ClaI-SacI-I end-BamHI-O end-KpnI 107bp
FT                   \ ctggcacgcgctggacgcgcatcgataagctcgagctcgagctttaatg
FT                   \ ctgtctcttgatcagatctcgggatcccctacttgtgtataagagtcag
FT                   \ ggtaccc, includes pBRG700 I end
FT                   -> pBRG1305 4000bp
FT                   1. pBR322 BamHI 4361bp 376..376, tet gene
FT                   mutagenesis
FT                   BamHI-NdeI 1924bp 376..2299, tet/ori
FT                   2. pBRG1305 BamHI-BamHI, IS50 O/IS50 I/tnp gene
FT                   3. pLS302 EcoRI
FT                   linker 29bp tatcaagttcctgagttcgattcgtccac
FT                   BamHI-NdeI, sacB gene
FT                   \ pUC8 241..-..478
FT                   -> II 6300bp
FT                   1. II EcoRI 6300bp, 5' to sacB gene
FT                   2. pUC4K EcoRI-EcoRI 1282bp 397..1679, kan gene
FT                   -> II-a 7800bp"
FT   misc_feature    1..20
FT                   /note="primer #3"
FT   misc_feature    24..42
FT                   /note="plasmid II-a O end"
XX
SQ   Sequence 78 BP; 14 A; 29 C; 20 G; 15 T; 0 other;
     ccatcgcgtc cgccatctcc agcagccgca cgcggcgcat ctcgggatcc cctacttgtg
     tataagagtc agggtacc
//