back Return to this vector's summary.
ID   LAMZD31    preliminary; circular DNA; SYN; 43700 BP.
XX
AC   M22642; M19164; M19165; M19166; M19167; M19168; ATCC37563;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Vertebrate/E.coli phage vector lambda ZD31 - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pZD1, pZD2 from pZIPneoSV(x)1 & oligo
RC   lambda ZD31 from pZD1 & Charon 30
RC   lambda ZD32 from pZD2 & Charon 30
RC   rpZD1 from lambda ZD31
RC   rpZD2 from lambda ZD32
RC   rpZDD1 from rpZD1
RC   rpZDD2 from rpZD2
RC   rpZd5 from rpZD1
RC   lambda ZD5 from rpZd5 & lambda ZD31
RC   p3P0 from pZIPneoSV(x)1 & MMLV
RA   Murphy A.J., Efstratiadis A.;
RT   "Cloning vectors for expression of cDNA libraries in mammalian cells";
RL   Proc. Natl. Acad. Sci. U.S.A. 84:8277-8281(1987).
XX
CC   Restriction digests of the clone give the following sizes (kb):
CC   EcoRI--19, 25. (ATCC staff)
CC   Contains Mo-MLV LTR for transcription of cDNA and neo; ori of SV40 and
CC   pBR322.
CC   A cell line suitable for transfection by released plasmid is Wgd5,
CC   ATCC CRL 1817.
CC   The plasmid insert can be released by homologous recombination between
CC   the 2 LTRs after growth at low temperature in E.coli RRI(pRK248),
CC   ATCC 47036.
CC   Allows expression of cloned cDNA in mammalian cells; can be used for
CC   library transduction.
CC   Medium is 1592 SM buffer.
CC   NM (lambda ZD31)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (phage)
CC   SP (ATCC)
CC   HO (bacteria-free lysate)(vertebrate cells)(E.coli)
CC   HO (E.coli RR1 pRK248 [ATCC 47036])(E.coli Wgd5 [CRL 1817])
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA ()
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pZIPneoSV(x)1 EcoRI
FT                   fill in
FT                   EcoRI
FT                   fill in
FT                   BamHI
FT                   2. oligo BamHI-EcoRI-BamHI 23bp
FT                   \ gatctatggatggatggaattcg
FT                   -> pZD1 [BamHI, EcoRI]
FT                   1. pZD1 NdeI
FT                   fill in
FT                   2. Charon 30 EcoRI
FT                   fill in
FT                   -> lambda ZD31 43700bp"
FT   misc_binding    0..0
FT                   /note="SIT unique EcoRI"
FT   rep_origin      0..0
FT                   /note="ORI bacteriophage lambda"
FT   promoter        0..0
FT                   /note="PRO Mo-MLV LTR"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   CDS             0..0
FT                   /note="ANT E. coli kanamycin resistance gene (kan)"
FT   CDS             0..0
FT                   /note="ANT E. coli neomycin phosphotransferase gene
FT                   (NPT); neomycin resistance gene (neo)"
FT   CDS             0..0
FT                   /note="ANT mammal G418 resistance gene (G418)"
XX
SQ   Sequence 1 BP; 0 A; 0 C; 0 G; 0 T; 1 other;
     n
//