back Return to this vector's summary.
ID   LAMZD35    preliminary; circular DNA; SYN; 43700 BP.
XX
AC   M22642; M19164; M19165; M19166; M19167; M19168; ATCC37565;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Vertebrate/E.coli phage vector lambda ZD35 - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pZD1, pZD2 from pZIPneoSV(x)1 & oligo
RC   lambda ZD31 from pZD1 & Charon 30
RC   lambda ZD32 from pZD2 & Charon 30
RC   [lambda ZD35 from Charon 30]
RC   rpZD1 from lambda ZD31
RC   rpZD2 from lambda ZD32
RC   rpZDD1 from rpZD1
RC   rpZDD2 from rpZD2
RC   rpZd5 from rpZD1
RC   lambda ZD5 from rpZd5 & lambda ZD31
RC   p3P0 from pZIPneoSV(x)1 & MMLV
RA   Murphy A.J., Efstratiadis A.;
RT   "Cloning vectors for expression of cDNA libraries in mammalian cells";
RL   Proc. Natl. Acad. Sci. U.S.A. 84:8277-8281(1987).
XX
CC   Restriction digests of the clone give the following sizes (kb):
CC   EcoRI--19, 25. (ATCC staff)
CC   Cloned cDNA expressed from LTR promoter; neo expressed from polyoma
CC   promoter; no splicing site; ori of SV40 and pBR322.
CC   A cell line suitable for transfection by released plasmid is Wgd5,
CC   ATCC CRL 1817.
CC   The plasmid insert can be released by homologous recombination between
CC   the 2 LTRs after growth at low temperature in E.coli RRI(pRK248),
CC   ATCC 47036.
CC   Allows expression of cloned cDNA in mammalian cells; can be used for
CC   transduction. Allows plasmid replication in mouse (WOP) and monkey
CC   (COS) cells.
CC   Medium is 1592 SM buffer.
CC   NM (lambda ZD35)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (phage)
CC   SP (ATCC)
CC   HO (bacteria-free lysate)(vertebrate cells)(E.coli)
CC   HO (E.coli RR1 pRK248 [ATCC 47036])(E.coli Wgd5 [CRL 1817])
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA ()
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pZIPneoSV(x)1 EcoRI
FT                   fill in
FT                   EcoRI
FT                   fill in
FT                   BamHI
FT                   2. oligo BamHI-EcoRI-BamHI gatctatggatggatggaattcg
FT                   -> pZD1 [BamHI, EcoRI]
FT                   1. lambda EcoRI
FT                   2. pZD1 EcoRI
FT                   -> lambda ZD1
FT                   1. lambda ZD1
FT                   recombination, between LTR's
FT                   -> rpZD1
FT                   1. rpZD1 remove 400bp
FT                   2. polyoma 433bp 5021..162, ori/early promoter
FT                   -> rpZD5
FT                   1. rpZD5 XbaI, complete
FT                   2. lambda ZD31 remove XbaI-XbaI, between LTR's
FT                   -> lambda ZD35 43700bp"
FT   misc_binding    0..0
FT                   /note="SIT unique EcoRI"
FT   rep_origin      0..0
FT                   /note="ORI bacteriophage lambda"
FT   promoter        0..0
FT                   /note="PRO Mo-MLV LTR"
FT   promoter        0..0
FT                   /note="PRO polyoma virus"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   CDS             0..0
FT                   /note="ANT E. coli kanamycin resistance gene (kan)"
FT   CDS             0..0
FT                   /note="ANT E. coli neomycin phosphotransferase gene
FT                   (NPT); neomycin resistance gene (neo)"
FT   CDS             0..0
FT                   /note="ANT mammal G418 resistance gene (G418)"
XX
SQ   Sequence 1 BP; 0 A; 0 C; 0 G; 0 T; 1 other;
     n
//