back Return to this vector's summary.
ID   M13B119    preliminary; circular DNA; SYN; 165 BP.
XX
AC   IG5134;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli phage vector M13B119 - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   M13K119W from M13K119 & oligo, EcoK
RC   M13B119 from M13K119W & oligo, EcoB
RA   Waye M.M.;
RT   "Use of M13 ping-pong vectors and T4 DNA polymerase in
RT   oligodeoxynucleotide-directed mutagenesis";
RL   Meth. Enzymol. 217:258-270(1993).
XX
RN   [2]
RC   M13K18 from M13mp18 & oligo
RC   M13K19 from M13mp19 & oligo
RC   M13B18 from M13mp18 & oligo
RC   M13B19 from M13mp19 & oligo
RC   M13mp18amIV from M13mp18 & oligo
RC   M13mp19amIV from M13mp19 & oligo
RC   M13K18TyrTS from M13K18 & M13mp93TyrTS
RC   M13K19TyrTS from M13K19 & M13mp93TyrTS
RC   M13mp93amIVTyrTS from M13mp93TyrTS & oligo
RA   Carter P., Bedouelle H., Winter G.;
RT   "Improved oligonucleotide site-directed mutagenesis using M13
RT   vectors";
RL   Nucleic Acids Res. 13:4431-4443(1985).
XX
RN   [3]
RC   M13K119 from M13K11
RC   M13B119W from M13K119
RA   Waye M.M., Mui F., Wong K.;
RT   ;
RL   Technique 1:188-188(1989).
XX
RN   [4]
RC   M13mp93 from M13mp series
RC   M13mp93TyrTS from M13mp93 & Bacillus TyrTS gene
RA   Winter G., Fersht A.R., Wilkinson A.J., Zoller M., Smith M.;
RT   "Redesigning enzyme structure by site-directed mutagenesis:
RT   tyrosyl tRNA synthetase and ATP binding";
RL   Nature 299:756-758(1982).
XX
CC   MCS. oligonucleotide linker.
CC   NM (M13B119)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pF4)(M13)
CC   BR (M13K119W)
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. M13mp8 SmaI 7229bp 6239..6239
FT                   phosphatase
FT                   2. oligo EcoK 60bp
FT                   \ aacccgggagtgctaaacccgggagtgctaaacccgggagtgctaaaccc
FT                   \ gggagtgcta, [15bp aacccgggagtgcta]
FT                   T4 DNA polymerase
FT                   -> M13K8.4 7289bp [4 copies of EcoK cassette]
FT                   1. M13mp11 7244bp
FT                   2. factor Xa site 183bp
FT                   \ atgaccatgattacgccaagcttgggctgcaggtcgactctagaggatat
FT                   \ cgagggtaggaattcccaacctgaaactgacgtgctgatgctgatgtgct
FT                   \ cgtgctaaaggggatccgtcgacctaccctcgatggatccccgggcgagc
FT                   \ tcgaattcactggcc
FT                   -> M13mp11 FX 7427bp
FT                   1. M13K8.4 EcoRI-SalI 76bp, 4 EcoK cass
FT                   \ M13mp8 6232..-..6248
FT                   Klenow:Klenow
FT                   2. M13mp11 FX StuI 7427bp, factor Xa site
FT                   -> phage 7503bp
FT                   1. phage SacI 7503bp, M13mp11 6278
FT                   Klenow:Klenow
FT                   -> M13K11 7503bp
FT                   1. M13K11 7503bp
FT                   2. oligo EcoK 45bp
FT                   \ ccctagcacgcaccggttagttgcacgcacacgttagtttcattg
FT                   -> M13K119 7548bp
FT                   1. M13K119 7548bp
FT                   2. oligo EcoK 45bp
FT                   \ ccctagcacgcaccggttagttgcacgcacacgttagtttcattg
FT                   -> M13K119W 7593bp
FT                   1. M13K119W 7593bp
FT                   2. oligo EcoB 56bp
FT                   \ attcccaacctgaaactgacgtgctgatgctgatgtgctcgtgcttaa
FT                   \ ggggatcc
FT                   -> M13B119 7649bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 165 BP; 37 A; 44 C; 48 G; 36 T; 0 other;
     atgaccatga ttacgccaag cttgggctgc aggtcgactc tagaggatat cgagggtagg
     aattcccaac ctgaaactga cgtgctgatg ctgatgtgct cgtgctaaag gggatccgtc
     gacctaccct cgatggatcc ccgggcgagc tcgaattcac tggcc
//