back Return to this vector's summary.
ID   M13K11RX   preliminary; circular DNA; SYN; 183 BP.
XX
AC   M22850; A01595;
XX
DT   15-JUN-1989 (Rel. 4, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli phage vector M13K11RX - incomplete, MCS.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-183
RC   from M13K11 & pXLHW7, frog H1 gene/H4 gene
RA   Shen W., Waye M.M.;
RT   "A novel method for generating a nested set of unidirectional
RT   deletion mutants using mixed oligodeoxynucleotides";
RL   Gene 70:205-211(1988).
XX
RN   [2]
RP   1-183
RC   M13K11RX
RA   Waye M.M.;
RT   ;
RL   Submitted (07-MAR-1989) by:
RL   Waye M.M., .
XX
RN   [3]
RC   M13K8.1, M13K8.2, M13K8.4 from M13mp8 & oligo
RC   phage from M13K8.4 & M13mp11 FX
RC   M13K11 from phage
RC   M13K11RX from M13K11
RC   M13K11.H4 from M13K11 & pXLHW7, histone H4 gene
RA   Waye M.M., Verhoeyen M.E., Jones P.J., Winter G.;
RT   "EcoK selection vectors for shotgun cloning into M13 and deletion
RT   mutagenesis";
RL   Nucleic Acids Res. 13:8561-8571(1985).
XX
RN   [4]
RC   pcX1H4W1 from histone H4 gene
RC   XLHW1, XLHW2, XLHW8, XLHW22 from pcX1H4W1
RC   XLHW11, XLHW23, XLHW24, XLHW25 from pcX1H4W1
RC   from lambda & XLHW series
RC   pXLHW7, pXLHW series from pBR325 & XLHW series
RA   Old R.W., Woodland H.R., Ballantine J.E., Aldridge T.C.,
RA   Newton C.A., Bains W.A., Turner P.C.;
RT   "Organization and expression of cloned histone gene clusters from
RT   Xenopus laevis and X. borealis";
RL   Nucleic Acids Res. 10:7561-7580(1982).
XX
CC   NCBI gi: 208693
CC   NM (M13K11RX)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (M13)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. M13mp8 SmaI 7229bp 6239..6239
FT                   phosphatase
FT                   2. oligo EcoK 60bp
FT                   \ aacccgggagtgctaaacccgggagtgctaaacccgggagtgctaaaccc
FT                   \ gggagtgcta, [15bp aacccgggagtgcta]
FT                   T4 DNA polymerase
FT                   -> M13K8.4 7289bp [4 copies of EcoK cassette]
FT                   1. M13mp11 7244bp
FT                   2. factor Xa site 183bp [see sequence]
FT                   -> M13mp11 FX 7427bp
FT                   1. M13K8.4 EcoRI-SalI 76bp, 4 EcoK cass
FT                   \ M13mp8 6232..-..6248
FT                   Klenow:Klenow
FT                   2. M13mp11 FX StuI 7427bp, factor Xa site
FT                   -> phage 7503bp
FT                   1. phage SacI 7503bp, M13mp11 6278
FT                   Klenow:Klenow
FT                   -> M13K11 7503bp
FT                   1. M13K11 XhoI 7503bp, 3' to SacI in EcoK cassette
FT                   mutagenesis
FT                   EcoRV 7503bp,
FT                   \ 3' to BamHI in EcoK cass/M13mp11 BamHI 6262
FT                   mutagenesis
FT                   -> M13K11RX 7500bp"
FT   misc_feature    152..164
FT                   /note="SIT factor X recognition site"
FT   CDS             1..>183
FT                   /note="GEN artificial protein gene;
FT                   NCBI gi: 208694"
XX
SQ   Sequence 183 BP; 41 A; 51 C; 58 G; 33 T; 0 other;
     atgaccatga ttacgccaag cttgggctgc aggtcgactc tagaggatat cgagggtagg
     aattcccaac ccgggagtgc taaacccggg agtgctaaac ccgggagtgc taaacccggg
     agtgctaggg gatccgtcga cctaccctcg atggatcccc gggcgagctc gagttcactg
     gcc
//