back Return to this vector's summary.
ID   M13M655    preliminary; circular DNA; SYN; 60 BP.
XX
AC   IG5018;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli phage vector M13m655 - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   M13m655, M13m663, M13m666 from M13mp8 & pBR322
RA   Fowlkes D.M., Adams M.D., Fowler V.A., Kay B.K.;
RT   "Multipurpose vectors for peptide expression on the M13 viral
RT   surface";
RL   Biotechniques 13:422-428(1992).
XX
CC   oligonucleotide epitope.
CC   NM (M13m655)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (M13mp8)(pBR322)
CC   BR (M13m663)(M13m666)
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. M13mp8 remove 6bp 1579..1585, 7223bp
FT                   mutagenic primer 6bp ctcgag
FT                   -> mutant M13mp8 7229bp [XhoI in AA1/AA2 in pIII gene]
FT                   1. mutant M13mp8 XhoI 7229bp 1580..1580
FT                   2. oligo XbaI-XhoI 33bp
FT                   \ gagcagaaactgatctctgaagaagacctgaac,
FT                   \ human c-myc gene epitope
FT                   -> phage 7262bp
FT                   1. phage remove, lacZ gene
FT                   2. pBR322, tet gene
FT                   -> M13m655 7200bp [no lacZ gene; XhoI & XbaI]"
FT   CDS             0..0
FT                   /note="GEN bacteriophage M13 pIII gene"
FT   misc_binding    0..0
FT                   /note="SIT XhoI"
FT   misc_feature    0..0
FT                   /note="SIT bacteriophage M13 pIII gene signal
FT                   peptide cleavage site"
FT   misc_feature    0..0
FT                   /note="SIT human c-myc gene epitope, recognized by
FT                   9E10 monoclonal antibody"
FT   misc_binding    0..0
FT                   /note="SIT XbaI"
FT   CDS             0..0
FT                   /note="ANT E. coli tetracycline resistance gene (tet),
FT                   from pBR322"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 60 BP; 20 A; 15 C; 14 G; 11 T; 0 other;
     tcctcgagag agcagaaact gatctctgaa gaagacctga actctagacc tgcgagaact
//