back Return to this vector's summary.
ID   P2UGCAT    preliminary; circular DNA; SYN; 7600 BP.
XX
AC   ATCC37815;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Saccharomyces/E.coli plasmid vector p2UGCAT - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pART1/N795 from pART1 & pG-N795
RC   p2UG from pUC18 & pSX26.1
RC   p2UGZ from p2UG & lacZ gene
RC   p2UGCAT from p2UG & cat gene
RA   Picard D., Schena M., Yamamoto K.R.;
RT   "An inducible expression vector for both fission and budding
RT   yeast";
RL   Gene 86:257-261(1990).
XX
RN   [2]
RC   pART1 from pUC118 & S.pombe ARS/ADH gene & S.cerevisiae LEU2 gene
RC   pRK172 from pAR3038 & linker
RC   pmei3.14' from pUC118 & mei3+ gene
RC   pmei3.14'(Nde) from pmei3.14' & oligo
RC   pME13.18 from pRK172 & pmei3.14'(Nde)
RA   McLeod M., Stein M., Beach D.;
RT   "The product of the mei3+ gene, expressed under the control of the
RT   mating-type locus, induces meiosis and sporulation in fission yeast";
RL   EMBO J. 6:729-736(1987).
XX
RN   [3]
RC   pSXG from MTV LTR, GRE
RC   pSX26.1, pSX26.2 from yeast 2 micron & URA3 gene & rat TA gene, GRE
RC   pXX46 from synthetic GRE
RC   pSS from yeast 2 micron & URA3 gene, no GRE
RC   pGPD-2 from pSV7d & PGK gene & TRP1 gene & yeast 2 micron ori
RC   pGPD-525 from pGPD-2 & N525, rat GRE gene
RC   pGPD-508 from pGPD-2 & N508, rat GRE gene
RC   pGPD-464 from pGPD-2 & N464, rat GRE gene
RC   pGPD-556a from pGPD-2 & N556a, rat GRE gene
RC   pGPD-556b from pGPD-2 & N556b, rat GRE gene
RC   pGPD-795 from pGPD-2 & N795, rat GRE gene
RC   pG-D from pGPD-556a & pUC18
RA   Schena M., Yamamoto K.R.;
RT   "Mammalian glucocorticoid receptor derivatives enhance
RT   transcription in yeast";
RL   Science 241:965-967(1988).
XX
RN   [4]
RC   [from none]
RA   Schneider J.C., Guarente L.;
RT   "Vectors for expression of cloned genes in yeast: regulation,
RT   overproduction, and underproduction";
RL   Meth. Enzymol. 194:373-388(1991).
XX
RN   [5]
RC   N556a, N556b, N525, N508, N464, N795 from mammal GRE region
RA   Schena M., Freedman L.P., Yamamoto K.R.;
RT   "Mutations in the glucocorticoid receptor zinc finger region that
RT   distinguish interdigitated DNA binding and transcriptional
RT   enhancement activities";
RL   Genes Dev. 3:1590-1601(1989).
XX
RN   [6]
RC   pAR3038 from pBR322 & T7 gene 10 promoter
RA   Studier F.W.;
RT   ;
RL   Unpublished (1987).
XX
RN   [7]
RC   pLGdelta312S from CYC1 gene promoter & E.coli lacZ gene
RA   Guarente L., Hoar E.;
RT   "Upstream activation sites of the CYC1 gene of Saccharomyces
RT   cerevisiae are active when inverted but not when placed
RT   downstream of the TATA box";
RL   Proc. Natl. Acad. Sci. U.S.A. 81:7860-7864(1984).
XX
RN   [8]
RC   pPB54 from HIS4 gene
RA   Donahue T.F., Farabaugh P.J., Fink G.R.;
RT   "The nucleotide sequence of the HIS4 region of yeast";
RL   Gene 18:47-59(1984).
XX
RN   [9]
RC   pJR41 from TUN gene
RA   Rine J., Hansen W., Hardeman E., Davis R.W.;
RT   "Targeted selection of recombinant clones through gene dosage
RT   effects";
RL   Proc. Natl. Acad. Sci. U.S.A. 80:6750-6754(1983).
XX
RN   [10]
RC   [pLG699-Z from pLG series]
RC   pLGSD5 from pLG699-Z & GAL1-GAL10 promoter
RA   Guarente L., Yocum R., Gifford P.;
RT   "A GAL10-CYC1 hybrid yeast promoter identifies the GAL4 regulatory
RT   region as an upstream site";
RL   Proc. Natl. Acad. Sci. U.S.A. 79:7410-7414(1982).
XX
RN   [11]
RC   pYE4 from TRP1 gene
RA   Kramer R.A., DeChiara T.M., Schaber M.D., Hilliker S.;
RT   "Regulated expression of a human interferon gene in yeast: control
RT   by phosphate concentration or temperature";
RL   Proc. Natl. Acad. Sci. U.S.A. 81:367-370(1984).
XX
RN   [12]
RC   YEp1PT from TRP1 gene
RA   Hitzeman R.A., Leung D.W., Perry L.J., Kohr W.T., Levine H.L.,
RA   Goeddel D.V.;
RT   "Secretion of human interferons by yeast";
RL   Science 219:620-625(1983).
XX
CC   Contains the CYC1 TATA region from S. cerevisiae (nt -178 to +49)
CC   fused at nt -178 to 3 copies of a 26 bp glucocorticoid response
CC   element (GRE) from the rat tyrosine aminotransferase gene.
CC   A BglII/BamHI fragment with a chloramphenicol acetyltransferase coding
CC   region, its own AUG codon, and some SV40 sequences was cloned into the
CC   BamHI site of the polylinker. The other polylinker sites are 3' to
CC   this insert.
CC   Expression of chloramphenicol acetyltransferase is hormone-inducible
CC   in both S. cerevisiae & Sc. pombe hosts, in the presence of a
CC   glucocorticoid receptor such as that encoded by pG-N795 (ATCC 37813)
CC   or pART1/N795 (ATCC 37814).
CC   The URA3 marker is from S. cerevisiae but complements the ura4 allele
CC   from S. pombe.
CC   Restriction digests of the clone give the following sizes (kb):
CC   BamHI--7.6, EcoRI--2.2 (doublet), 1.7, 1.4; KpnI--7.6. (ATCC staff)
CC   Medium is 1227 LB plus ampicillin.
CC   NM (p2UGCAT)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli HB101)(Schizosaccharomyces pombe)(E.coli)(S.pombe)
CC   HO (Saccharomyces cerevisiae)(Schizosaccharomyces pombe SP63)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA ()
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pUC18 EcoRI 2686bp 451..451
FT                   2. yeast 2 micron EcoRI-EcoRI 2406bp 2..2408, ori
FT                   -> plasmid 5092bp
FT                   1. plasmid HindIII 5092bp 30..30
FT                   2. YEp24 HindIII-HindIII 1166bp 2273..3439, URA3 gene
FT                   -> plasmid2 6258bp
FT                   1. plasmid2 6258bp
FT                   2. yeast 300bp, CYC1 gene promoter
FT                   -> pLGdelta312S 6500bp
FT                   1. pLGdelta312S XhoI 6500bp, -178 between CYC1 UAS
FT                   \ and TATA
FT                   2. oligo XhoI-XhoI 26bp, rat TA gene GRE
FT                   -> pSX26.1 6500bp
FT                   1. pSX26.1 remove BamHI-EcoRI, +50 CYC1 gene/lacZ gene
FT                   \ 6000bp
FT                   2. linker BamHI-SmaI-KpnI-SacI-EcoRI 33bp
FT                   \ aaacacggatccccgggtaccgagctcgaattc
FT                   -> p2UG 6000bp
FT                   1. p2UG BamHI 6000bp
FT                   2. pSV2-cat BglII-BamHI 1570bp 1800..3370,
FT                   \ cat gene/SV40
FT                   -> p2UGCAT 7600bp"
FT   misc_binding    0..0
FT                   /note="MCS BamHI-SmaI-KpnI-SacI-EcoRI"
FT   misc_binding    0..0
FT                   /note="SIT unique BamHI-SmaI-KpnI-SacI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   rep_origin      0..0
FT                   /note="ORI yeast 2 micron"
FT   promoter        0..0
FT                   /note="PRO yeast CYC1 gene"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   CDS             0..0
FT                   /note="ANT yeast URA3 gene"
FT   CDS             0..0
FT                   /note="ANT E. coli chloramphenicol acetyltransferase
FT                   gene (cat); chloramphenicol resistance gene (cmr/cml)"
XX
SQ   Sequence 33 BP; 9 A; 11 C; 8 G; 5 T; 0 other;
     aaacacggat ccccgggtac cgagctcgaa ttc
//