back Return to this vector's summary.
ID   PACRP25BT  preliminary; circular DNA; SYN; 105 BP.
XX
AC   D01049;
XX
DT   20-SEP-1991 (Rel. 6, Created)
DT   01-APR-1995 (Rel. 11, Last updated, Version 1)
XX
DE   Insect baculovirus vector pAcRP25.Bt - incomplete,protoxin/polyhedrin.
XX
KW   cloning vector; promoter; delta endotoxin; insecticidal activity;
KW   polyhedrin; protoxin.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-105
RC   pUCBt1 from pUC18 & pIC4, B.thuringiensis protoxin gene
RC   pUCBt5 from pUCBt1 & oligo
RC   pBt6 from pUCBt5 & linker
RC   pAcRP25.Bt from pBt6 & pAcRP25
RC   plasmid from pUC8/6/8 & linker
RC   pAcUW2 from plasmid & p10 promoter & pCH110
RC   pAcUW2.Bt from pAcUW2 & pBT6
RA   Merryweather A.T., Weyer U., Harris M.P., Hirst M., Booth T.,
RA   Possee R.D.;
RT   "Construction of genetically engineered baculovirus insecticides
RT   containing the Bacillus thuringiensis subsp. kurstaki HD-73 delta
RT   endotoxin";
RL   J. Gen. Virol. 71:1535-1544(1990).
XX
RN   [2]
RC   pIC4 from B.thuringiensis protoxin gene
RA   Ely S.;
RT   ;
RL   Unpublished (1990).
XX
RN   [3]
RC   pAcEI-I from pAT153 & polyhedrin gene fragment
RC   pAcEI-I15 from pAT153 & pAcEI-I
RC   pAcEI-I15/69 from pAcEI-I15
RC   pUC8/6 from pUC8
RC   pUC8/6/8 from pUC8/6 & polyhedrin gene fragment
RC   pAcRP1, pAcRP5 from pUC8/6/8 & pAcEI-I15/69
RC   pAcRP25 from pAcRP5
RA   Possee R.D.;
RT   "Cell-surface expression of influenza virus haemagglutinin in insect
RT   cells using a baculovirus vector";
RL   Virus Res. 5:43-59(1986).
XX
CC   NCBI gi: 220927
CC   NM (pAcRP25.Bt)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (virus)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (B.thuringiensis subsp. kurstaki HD-73 delta endotoxin)
CC   PA (A. californica nuclear polyhedrosis virus genes)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. B.thuringiensis NdeI-NdeI, protoxin gene
FT                   -> pIC4 19700bp
FT                   1. pUC18 NdeI
FT                   calf intestinal alkaline phosphatase
FT                   2. pIC4 NdeI-NdeI, B.thuringiensis protoxin gene
FT                   -> pUCBt1 6500bp
FT                   1. pUCBt1 remove small BamHI-NsiI, 5' protoxin gene
FT                   calf intestinal alkaline phosphatase
FT                   2. oligo BamHI-NsiI
FT                   gatcctataaatatggataacaatccgaacatcaatgaatgca
FT                   -> pUCBt5 6400bp
FT                   1. pUCBt5 NdeI, 3' protoxin gene
FT                   Klenow fill in
FT                   calf intestinal alkaline phosphatase
FT                   BamHI linker
FT                   -> pBt6 6400bp
FT                   1. pAT153 EcoRI
FT                   2. AcMNPV EcoRI-EcoRI, EcoRI 1/polyhedrin gene
FT                   -> pAcEI-I
FT                   1. pAT153 remove small EcoRI-BamHI
FT                   2. pAcEI-I EcoRI-BamHI 4200bp
FT                   -> pAcEI-I15
FT                   1. pAcEI-I15 BamHI
FT                   BAL31 nuclease, removes 203bp polyhedrin CDS
FT                   Klenow fill in
FT                   BamHI linker, -32bp 5' to polyhedrin ATG
FT                   -> pAcEI-I15/69
FT                   1. pUC8 BamHI, MCS
FT                   fill in
FT                   -> pUC8/6 [unique BamHI in polyhedrin]
FT                   1. pUC8/6 EcoRI
FT                   2. AcMNPV EcoRI-EcoRI, EcoRI 1/polyhedrin gene
FT                   -> pUC8/6/8
FT                   1. pUC8/6/8 BamHI, 3' to polyhedrin
FT                   Klenow fill in
FT                   remove XhoI-BamHI, MCS
FT                   2. pAcEI-I15/69 XhoI-BamHI 2100bp
FT                   -> pAcRP5 [unique BamHI in polyhedrin]
FT                   1. pAcRP5, 5' UTR polyhedrin gene
FT                   -> pAcRP25
FT                   1. pBt6 BamHI-BamHI, protoxin gene
FT                   2. pAcRP25 BamHI
FT                   calf intestinal alkaline phosphatase
FT                   -> pAcRP25.Bt 12900bp"
FT   misc_feature    4..4
FT                   /note="B. thuringiensis protoxin transcription
FT                   initiation site"
FT   CDS             70..>105
FT                   /note="GEN B. thuringiensis protoxin, amino terminal;
FT                   NCBI gi: 220928"
XX
SQ   Sequence 105 BP; 41 A; 17 C; 12 G; 35 T; 0 other;
     ataagtattt tactgttttc gtaacagttt tgtaataaaa aaacctataa atatccggat
     cctataaata tggataacaa tccgaacatc aatgaatgca ttcct
//