back Return to this vector's summary.
ID   PACUW2BT   preliminary; circular DNA; SYN; 123 BP.
XX
AC   D01041;
XX
DT   20-SEP-1991 (Rel. 6, Created)
DT   01-APR-1995 (Rel. 11, Last updated, Version 1)
XX
DE   Insect baculovirus vector pAcUW2.Bt - incomplete, protoxin/p10 prom.
XX
KW   cloning vector; delta endotoxin; insecticidal activity; polhedrin;
KW   protoxin; p10 promoter.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-123
RC   pUCBt1 from pUC18 & pIC4, B.thuringiensis protoxin gene
RC   pUCBt5 from pUCBt1 & oligo
RC   pBt6 from pUCBt5 & linker
RC   pAcRP25.Bt from pBt6 & pAcRP25
RC   plasmid from pUC8/6/8 & linker
RC   pAcUW2 from plasmid & p10 promoter & pCH110
RC   pAcUW2.Bt from pAcUW2 & pBt6
RA   Merryweather A.T., Weyer U., Harris M.P., Hirst M., Booth T.,
RA   Possee R.D.;
RT   "Construction of genetically engineered baculovirus insecticides
RT   containing the Bacillus thuringiensis subsp. kurstaki HD-73 delta
RT   endotoxin";
RL   J. Gen. Virol. 71:1535-1544(1990).
XX
RN   [2]
RC   pAcEI-P from pUC8/6/8 & AcMNPV p10 gene
RC   pAcUW1 from pAcEI-P & pAcp10+1
RC   pAcUW1-lacZ from pAcUW1 & pCH110
RC   pPH1 from pUC8/6/8
RC   pAcUW1-PH from pAcUW1 & pPH1
RA   Weyer U., Knight S., Possee R.D.;
RT   "Analysis of very late gene expression by Autographa californica
RT   nuclear polyhedrosis virus and the further development of multiple
RT   expression vectors";
RL   J. Gen. Virol. 71:1525-1534(1990).
XX
RN   [3]
RC   pAcp10+5, pAcp10 series from pAT153 & AcNPV p10 gene
RC   pAcp10+4 from pAcp10+5 & linker
RC   pAcp10+1 from pUC18 & pAcp10+4
RC   pAcp10+1.CAT, pAcp10.CAT series from pSV0-cat & linker & pAcp10 series
RC   from pAcp10+1.CAT & pCH110-mod
RA   Weyer U., Possee R.D.;
RT   "Functional analysis of the p10 gene 5' leader sequence of the
RT   Autographa californica nuclear polyhedrosis virus";
RL   Nucleic Acids Res. 16:3635-3653(1988).
XX
RN   [4]
RC   pCH110-BglII from pCH110 & linker
RA   Possee R.D., Howard S.C.;
RT   "Analysis of the polyhedrin gene promoter of the Autographa
RT   californica nuclear polyhedrosis virus";
RL   Nucleic Acids Res. 15:10233-10248(1987).
XX
CC   NCBI gi: 220925
CC   NM (pAcUW2.Bt)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (virus)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (B.thuringiensis subsp. kurstaki HD-73 delta endotoxin)
CC   PA (A. californica nuclear polyhedrosis virus genes)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. B.thuringiensis NdeI-NdeI, protoxin gene
FT                   -> pIC4 19700bp
FT                   1. pUC18 NdeI
FT                   calf intestinal alkaline phosphatase
FT                   2. pIC4 NdeI-NdeI, B.thuringiensis protoxin gene
FT                   -> pUCBt1 6500bp
FT                   1. pUCBt1 remove small BamHI-NsiI, 5' protoxin gene
FT                   calf intestinal alkaline phosphatase
FT                   2. oligo BamHI-NsiI
FT                   gatcctataaatatggataacaatccgaacatcaatgaatgca
FT                   -> pUCBt5 6400bp
FT                   1. pUCBt5 NdeI, 3' protoxin gene
FT                   Klenow fill in
FT                   calf intestinal alkaline phosphatase
FT                   BamHI linker
FT                   -> pBt6 6400bp
FT                   1. pUC8/6/8 EcoRV
FT                   BglII linker
FT                   -> pUC8/6/8-BglII
FT                   1. pCH110 BglII
FT                   fill in
FT                   -> pCH110-BglII
FT                   1. pUC8/6/8-BglII BglII
FT                   2. pCH110-BglII EcoRI
FT                   Klenow fill in:Klenow fill in
FT                   BglII linker:BglII linker
FT                   BglII-BamHI 577bp, 3' lacZ gene/SV40 polyA
FT                   -> plasmid
FT                   1. pAT153 HindIII
FT                   2. AcNPV HindIII-HindIII, 5' p10 gene/HindIII Q frag
FT                   -> pAcHQ
FT                   1. pAcHQ BglII, 152bp 3' to p10 ATG
FT                   BAL31 nuclease
FT                   S1 nuclease
FT                   calf intestinal phosphatase
FT                   BglII linker:BglII linker
FT                   -> pAcp10+5
FT                   1. pAcp10+5 BglII
FT                   Klenow to remove 3' A
FT                   S1 nuclease
FT                   calf intestinal phosphatase
FT                   BamHI linker:BamHI linker
FT                   -> pAcp10+4
FT                   1. pUC18 BamHI
FT                   fill in
FT                   SalI-PstI
FT                   2. pAcp10+4 XhoI-PstI, p10 promoter/pAT153
FT                   -> plasmidA
FT                   1. plasmidA BamHI, near p10 ATG
FT                   Klenow blunt end
FT                   BglII linker
FT                   -> pAcp10+1
FT                   1. pAcp10+1 SmaI
FT                   BamHI linker
FT                   -> plasmid2
FT                   1. plasmid remove small BglII-BamHI
FT                   2. plasmid2 BglII-BamHI 230bp, p10 promoter
FT                   -> pAcUW2 10800bp
FT                   1. pAcUW2 BglII
FT                   calf intestinal alkaline phosphatase
FT                   2. pBt6 BglII-BamHI, Bt toxin gene
FT                   -> pAcUW2.Bt 14500bp"
FT   misc_feature    4..4
FT                   /note="B. thuringiensis protoxin transcription
FT                   initiation site"
FT   CDS             88..>123
FT                   /note="GEN B. thuringiensis protoxin, amino terminal;
FT                   NCBI gi: 220926"
XX
SQ   Sequence 123 BP; 52 A; 18 C; 9 G; 44 T; 0 other;
     ataagaatta ttatcaaatc atttgtatat taattaaaat actatactgt aaattacatt
     ttatttacaa tcacagatcc tataaatatg gataacaatc cgaacatcaa tgaatgcatt
     cct
//