back Return to this vector's summary.
ID   PAD10SACB2 preliminary; circular DNA; SYN; 123 BP.
XX
AC   IG5181;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pAd10sacBII - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   plasmid from pNS582tet14Ad10 or pAd10 & oligo
RC   pAd10sacBII from plasmid & pBE501 & linker
RA   Pierce J.C., Sauer B., Sternberg N.;
RT   "A positive selection vector for cloning high molecular weight DNA
RT   by the bacteriophage P1 system: improved cloning efficacy";
RL   Proc. Natl. Acad. Sci. U.S.A. 89:2056-2060(1992).
XX
RN   [2]
RC   pNS582tet14 from pBR322 & pNS582
RC   pNS582tet14Ad10 or pAd10 from pNS582tet14 & adenovirus
RA   Sternberg N., Ruether J., DeRiel K.;
RT   "Generation of a 50,000-member human DNA library with an average
RT   DNA insert size of 75-100 kbp in a bacteriophage P1 cloning
RT   vector";
RL   New Biol. 2:151-162(1990).
XX
RN   [3]
RC   phage from lambda ZAP & Bacillus amyloliquefaciens sacB gene
RC   pBE300, pBE301 from pBR322 & phage
RC   pBE20 from pTZ18R & pC194
RC   pBE501, pBE504 from pBE301 & pBE20
RA   Tang L.B., Lenstra R., Borchert T.V., Nagarajan V.;
RT   "Isolation and characterization of levansucrase-encoding gene from
RT   Bacillus amyloliquefaciens";
RL   Gene 96:89-93(1990).
XX
RN   [4]
RC   pNS582 from pBR322 & phage P1
RA   Sternberg N.;
RT   "A bacteriophage P1 cloning system for the isolation, amplification
RT   and recovery of DNA fragments as large as 100 kbp";
RL   Proc. Natl. Acad. Sci. U.S.A. 87:103-107(1990).
XX
RN   [5]
RC   pNS582tet14AD10 or pAd10 from pNS582tet14
RC   pAd10sacBII from pAd10
RA   Sternberg N.;
RT   "Cloning high molecular weight DNA fragments by the bacteriophage
RT   P1 system";
RL   Trends Genet. 8:11-16(1992).
XX
RN   [6]
CC   MCS. oligonucleotide linker.
CC   NM (pAd10sacBII)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pNS582tet14Ad10 or pAd10 from pBR322 & P1)(pBE501)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. lambda ZAP EcoRI, lacZ [unique EcoRI]
FT                   2. B. amyloliquefaciens EcoRI-EcoRI 2300bp, sacB gene
FT                   -> phage
FT                   1. pTZ18R HindIII 2861bp 163..163
FT                   2. pC194 HindIII 2910bp 2436..2436, complete
FT                   -> pBE20 5771bp
FT                   1. pBR322 EcoRI 4361bp 4360..4360
FT                   2. phage EcoRI-EcoRI 2300bp, sacB gene
FT                   -> pBE301 6661bp
FT                   1. pBE301 EcoRI-EcoRI 2300bp, sacB gene
FT                   2. pBE20 EcoRI 5771bp, pTZ18R 214..214
FT                   -> pBE501 8071bp
FT                   1. pBR322 4361bp
FT                   2. phage P1, loxP/ori/kan/lyt/loxP
FT                   -> pNS582
FT                   1. pBR322 EcoRI-NdeI 2298bp 4360..4361..2297, tet gene
FT                   fill in:fill in
FT                   2. pNS582 remove BamHI-SalI 276bp, pBR322 376..652 tet
FT                   fill in:fill in
FT                   -> pNS582tet14
FT                   1. pNS582tet14 ScaI, pBR322 3849 between ori and amp
FT                   2. adenovirus ScaI-BamHI, stuffer
FT                   fill in:fill in
FT                   -> pNS582tet14Ad10
FT                   1. pNS582tet14Ad10 remove BamHI-SalI 276bp, tet gene
FT                   \ pBR322 376..652
FT                   2. oligo SnaBI-SfiI-SalI-Sp6 prom-BamHI-T7 prom-NotI-
FT                   \ P1 C1 rep-E. coli promoter 123bp
FT                   \ tacgtaggcctaattggccgtcgacatttaggtgacactatagaaggatc
FT                   \ ctctccctatagtgagtcgtattagcggccgcaaatttattagagcaata
FT                   \ tagtcctacaatgtcaagctcga
FT                   -> plasmid
FT                   1. plasmid SnaBI
FT                   2. pBE501 EcoRI-EcoRI 1600bp, Bacillus sacB gene
FT                   blunt-SpeI-EcoRI linker 12bp actagtgaattc:EcoRI-SpeI-
FT                   \ blunt linker 12bp gaattcactagt
FT                   -> pAd10sacBII [SalI next to sacB]"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 123 BP; 35 A; 27 C; 27 G; 34 T; 0 other;
     tacgtaggcc taattggccg tcgacattta ggtgacacta tagaaggatc ctctccctat
     agtgagtcgt attagcggcc gcaaatttat tagagcaata tagtcctaca atgtcaagct
     cga
//