back Return to this vector's summary.
ID   PAL147     preliminary; circular DNA; SYN; 147 BP.
XX
AC   M10046;
XX
DT   20-MAY-1987 (Rel. 2, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pAL147 - incomplete, SV40 147 bp palindrome.
XX
KW   cloning vector; palindrome.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-146
RC   pAL147
RA   Warren G.J.;
RT   ;
RL   Submitted (14-AUG-1985) by:
RL   Warren G.J., .
XX
CC   The presence of the palindrome apparently inhibited the spontaneous
CC   multimerization of plasmids that occur in Rec+ strains of E.coli.
CC   NCBI gi: 207910
CC   NM (pAL147)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli K-12)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (E.coli K-12)(pSVoriH)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. palindrome BglII-BglII 147bp
FT                   \ agatctttttgcaaaagcctaggcctccaaaaaagcctcctcactacttc
FT                   \ tggaatagctcagaggccgaggcggcctcggcctctgagctattccagaa
FT                   \ gtagtgaggaggcttttttggaggcctaggcttttgcaaaaagatct
FT                   -> pSVoriH 147bp
FT                   1. pBR322 4361bp
FT                   2. pSVoriH 147bp, SV40 palindrome
FT                   -> pAL147 4508bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 147 BP; 37 A; 36 C; 37 G; 37 T; 0 other;
     agatcttttt gcaaaagcct aggcctccaa aaaagcctcc tcactacttc tggaatagct
     cagaggccga ggcggcctcg gcctctgagc tattccagaa gtagtgagga ggcttttttg
     gaggcctagg cttttgcaaa aagatct
//