back Return to this vector's summary.
ID   PARAUG     preliminary; circular DNA; SYN; 60 BP.
XX
AC   M55276;
XX
DT   30-JAN-1991 (Rel. 6, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Vertebrate Japanese encephalitis virus vector NS1 pARAUG - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-60
RC   pARAUG from pAR2529 & linker
RC   [pPM6 from pPM series]
RC   plasmid from pPM6 & linker
RC   plasmid2 from plasmid & pUC19
RC   pARNS1 from pARAUG & plasmid
RC   pARNS1s from pARNS1
RA   Fan W., Mason P.W.;
RT   "Membrane association and secretion of the Japanese encephalitis
RT   virus NS1 protein from cells expressing NS1 cDNA";
RL   Virology 177:470-476(1990).
XX
RN   [2]
RC   pGS53 from pUC13 & vaccinia virus P7.5 gene promoter
RC   pTF7-3 from pGS53 & pAR1173, T7 gene 1
RC   vTF7-3 from pTF7-3 & vaccinia virus tk gene
RC   pTF7LZ-1 from pAR2529 & pWS61, lacZ gene
RC   pTF7CAT-1 from pAR2529 & pGS30, cat gene
RA   Fuerst T.R., Niles E.G., Studier F.W., Moss B.;
RT   "Eukaryotic transient expression system based on recombinant
RT   vaccinia virus that synthesizes bacteriophage T7 RNA polymerase";
RL   Proc. Natl. Acad. Sci. U.S.A. 83:8122-8126(1986).
XX
RN   [3]
RC   pPM-2, pPM-4, pPM-5, pPM-6, pPM-7 from pBR322 & JEV
RA   McAda P.C., Mason P.W., Schmaljohn C.S., Dalrymple J.M., Mason T.L.,
RA   Fournier M.J.;
RT   "Partial nucleotide sequence of the Japanese encephalitis virus
RT   genome";
RL   Virology 158:348-360(1987).
XX
RN   [4]
RC   pAR1173 from T7 gene 1
RA   Davanloo P., Rosenberg A.H., Dunn J.J., Studier F.W.;
RT   "Cloning and expression of the gene for bacteriophage T7 RNA
RT   polymerase";
RL   Proc. Natl. Acad. Sci. U.S.A. 81:2035-2039(1984).
XX
RN   [5]
RC   pWS61 from lacZ gene
RA   Majmdar A.;
RT   ;
RL   Unpublished (1986).
XX
CC   NCBI gi: 208950
CC   NM (pARAUG)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (virus)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA ()
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 BamHI 4361bp 376..376, tet
FT                   2. T7 HhaI-HhaI 122bp 24106..24228, -104 to +19
FT                   \ Tphi term
FT                   -> pAR939 4483bp
FT                   1. pAR939
FT                   -> pAR2516
FT                   1. pBR322 BamHI 4361bp 376..376, tet
FT                   2. T7 TaqI-XbaI 48bp 22880..22928, phi10
FT                   BamHI linker 10bp cgggatcccg:BamHI linker 10bp
FT                   \ cgggatcccg
FT                   -> pAR1959 4409bp
FT                   1. pAR1959
FT                   -> pET-1
FT                   1. pET-1
FT                   -> pET-2
FT                   1. pET-2
FT                   2. pAR2516
FT                   -> pAR2529
FT                   1. pAR2529 HindIII, pBR322 30
FT                   fill in
FT                   BamHI, Met codon between T7 prom and BamHI in MCS
FT                   2. oligo ATG-HindIII-BamHI 60bp
FT                   \ gggagaccacaacggtttccctctagcgggatcaccatgaagcttggatc
FT                   \ cggctgctaa
FT                   -> pARAUG"
FT   CDS             37..60
FT                   /note="GEN Japanese encephalitis virus NS1 protein;
FT                   NCBI gi: 208951"
XX
SQ   Sequence 60 BP; 14 A; 17 C; 17 G; 12 T; 0 other;
     gggagaccac aacggtttcc ctctagcggg atcaccatga agcttggatc cggctgctaa
//