back Return to this vector's summary.
ID   PARHS3     preliminary; circular DNA; SYN; 3422 BP.
XX
AC   IG5080;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pARHS3 - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pARHS1 from pAR3040 & pKG1023, parB
RC   pARHS2 from pARHS1
RC   pARHS3 from pARHS2
RA   De Moerlooze L., Struman I., Renard A., Martial J.A.;
RT   "Stabilization of T7-promoter-based pARHS expression vectors using
RT   the parB locus";
RL   Gene 119:91-93(1992).
XX
RN   [2]
RC   mini-F from F factor
RC   MiniRK2 from RK2
RC   pFN13 from RSF1010
RC   pKG1020 from pGEM-3 & pPR633, R1 parB
RC   pKG1021 from pKG1020 & pGEM-4
RC   pKG1022 from pKG1021 & Tn5, kan gene
RC   pKG1023 from pKG1021 & Tn9, cat gene
RA   Gerdes K.;
RT   "The parB (hok/sok) locus of plasmid R1: a general purpose plasmid
RT   stabilization system";
RL   Biotechnology 6:1402-1405(1988).
XX
CC   MCS. not original sequence.
CC   NM (pARHS3)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pAR3040)(pKG1023 from R1)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322
FT                   2. R1, parB gene
FT                   -> pPR633
FT                   1. pGEM-3 remove BamHI-EcoRI 21bp 38..59,
FT                   \ 2846bp
FT                   2. pPR633 BamHI-EcoRI 580bp, R1 parB gene
FT                   -> pKG1020 3426bp
FT                   1. pKG1020 remove EcoRI-PvuII 46bp 59..105, 3380bp
FT                   2. pGEM-4 EcoRI-PvuII 98bp 11..109
FT                   -> pKG1021 3478bp
FT                   1. pKG1021 BamHI 3478bp 38..38
FT                   2. Tn9 MboI/Sau3A-MboI/Sau3A 1102bp, cat gene/#V00622
FT                   -> pKG1023 4580bp
FT                   1. pET-3a PvuII 4600bp, pBR322 2069
FT                   2. pKG1023 EcoRI-HincII 600bp, parB locus
FT                   -> pARHS1 5200bp
FT                   1. pARHS1 remove SalI-BamHI 276bp, tet gene C-terminal
FT                   \ pBR322 376..652
FT                   remove EcoRI-EcoRV 189bp, pBR322 4360..4361..188
FT                   -> pARHS2 4700bp
FT                   1. pARHS2 remove XbaI-BamHI, MCS/3400bp
FT                   2. oligo XbaI-BamHI 58bp ggatccgctagcccatgggtatatctcc
FT                   \ ttcttaaagttaaacaaaattatttctaga
FT                   -> pARHS3 3422bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 58 BP; 18 A; 12 C; 9 G; 19 T; 0 other;
     ggatccgcta gcccatgggt atatctcctt cttaaagtta aacaaaatta tttctaga
//