back Return to this vector's summary.
ID   PART7      preliminary; circular DNA; SYN; 4900 BP.
XX
AC   X69707;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pART7 - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pART7 from pGEM-9Zf- & CaMV 35S promoter & ocs3' region
RC   plasmid from pMON530 & pGA643
RC   pART27 from plasmid & pGEM-5Zf+
RA   Gleave A.P.;
RT   "A versatile binary vector system with a T-DNA organisational
RT   structure conducive to efficient integration of cloned DNA into the
RT   plant genome";
RL   Plant Mol. Biol. 20:1203-1207(1992).
XX
RN   [2]
RC   [pGA515 from pGA series]
RC   pGA581, pGA582, pGA583 from pGA580
RC   pGA553 series from pGA492
RC   pGA642 from pTiA6 & pGA515, nos promoter
RC   pGA643 from pTiA6 & CaMV 35S promoter
RA   An G., Ebert P.R., Mitra A., Ha S.B.;
RT   "Binary vectors";
RL   Plant Molecular Biology Manual A3:1-19(1988).
RL   Gelvin S.B., Schilperoort R.A., Verma D.P., eds.,
RL   Kluwer Academic Publishers, Dordrecht.
XX
RN   [3]
RC   pB0542 from Agrobacterium A281
RA   Montoya A.L., Chilton M.D., Gordon M.P., Sciaky D., Nester E.W.;
RT   "Octopine and nopaline metabolism in Agrobacterium tumefaciens and
RT   crown gall tumors";
RL   J. Bacteriol. 129:101-107(1977).
XX
RN   [4]
RC   pT37H23 from pTiT37 & Tn5, neo
RC   [pGA342 from pGA series]
RC   pGA355 from pGA342 & pT37H23
RC   pGA355-147 from pGA355
RC   [pGA428 from pGA series]
RC   pGA430 from pGA355-147 & pGA428
RC   pGA435 from pTiT37 & pGA430
RC   pGA437 from pGA435 & pTJS75
RC   pGA446 from pGA435
RC   pGA451 from pTJS75
RC   pGA452 from MUA-10
RC   pGA469, pGA470 from pGA446 & pGA451
RC   pGA471 from pGA469 & pGA452
RC   pGA472 from pGA470 & pGA452
RC   pGA482 from pHC79 & pTJS75 & pAL4404
RC   [pGA492 from pGA series]
RA   An G., Watson B.D., Stachel S., Gordon M.P., Nester E.W.;
RT   "New cloning vehicles for transformation of higher plants";
RL   EMBO J. 4:277-284(1985).
XX
RN   [5]
RC   pGA580 from pGA492
RA   An G.;
RT   "Binary Ti vectors for plant transformation and promoter analysis";
RL   Meth. Enzymol. 167:0-0(1988).
XX
RN   [6]
RC   pGA553 series from pGA492
RA   An G., Ebert P.R., Yi B.Y., Choi C.H.;
RT   "Both TATA box and upstream regions are required for the nopaline
RT   synthase promoter activity in transformed tobacco cells";
RL   Mol. Gen. Genet. 203:245-250(1986).
XX
CC   MCS. not original sequence.
CC   NM ()
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pGEM9Zf-)
CC   BR (pART27 from pMON530)
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pGEM-9Zf- NotI 2925bp 2901..2901
FT                   2. CaMV NotI-XhoI, 35S promoter
FT                   3. linker XhoI-EcoRI-KpnI-SmaI-ClaI-HindIII-BamHI-XbaI
FT                   \ 121bp caatcccactatccttcgcaagacccttcctctatataag
FT                   \ gaagttcatttcatttggagaggacacgctcgaggaattcggtaccccgg
FT                   \ gttcgaaatcgataagcttggatcctctaga
FT                   4. Ti plasmid XbaI-NotI, OCS 3' region
FT                   -> pART7 4900bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 121 BP; 32 A; 32 C; 25 G; 32 T; 0 other;
     caatcccact atccttcgca agacccttcc tctatataag gaagttcatt tcatttggag
     aggacacgct cgaggaattc ggtaccccgg gttcgaaatc gataagcttg gatcctctag
     a
//