back Return to this vector's summary.
ID   PCB302     preliminary; circular DNA; SYN; 7000 BP.
XX
AC   IG5122;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pCB302b - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pCB302 from pKO-1 & lambda, terminator t0
RC   pCB303 from pCB267 & pRK290 & pRK2013
RC   pCB237 from pCB302 & pBR322
RC   pCB238 from pCB302 & pBR322
RC   pCB304 from pCB238
RA   Schneider K., Beck C.F.;
RT   "New expression vectors for identifying and testing signal
RT   structures for initiation and termination of transcription";
RL   Meth. Enzymol. 153:452-461(1987).
XX
RN   [2]
RC   pCB149 from pBR322 & lac promoter
RC   pCB161 from pFD51 & Tn10
RC   [pCB162 from pFD51 & Tn10]
RC   pCB168 from pCB161 & pUK217
RC   pCB170 from pIN-II-A1 & pUK217
RC   pCB171 from pCB170 & pCB168
RC   pCB172 from pCB162 & pCB171
RC   pCB178 from pCB172
RC   pCB180 from pFD51 & M13mp9
RC   pCB182 from pCB180 & pCB178
RC   pCB192 from pCB180 & pCB178
RC   pCB194 from pBR322 & pCB182
RC   pCB197 from pCB161 & pKC7
RC   pCB199 from pCB197 & pSB53
RC   pCB205 from pCB194 & pCB192
RC   pCB208 from pCB161 & pCB192
RC   [pCB212 from pCB series]
RC   pCB214 from pCB182 & pCB161 & pCB212
RC   pCB216 from pCB214 & lambda, t0 terminator
RC   pCB217 from pCB212 & pCB216
RC   pCB221 from pCB199 & pCB197
RC   pCB231 from pCB208 & pCB221
RC   pCB249 from pCB221
RC   pCB250 from pCB231
RC   pCB264 from pFD51 & pCB249
RC   pCB267 from pCB182 & pCB250
RC   pCB296 from pCB205
RC   pCB297 from pCB208
RA   Schneider K., Beck C.F.;
RT   "Promoter-probe vectors for the analysis of divergently arranged
RT   promoters";
RL   Gene 42:37-48(1986).
XX
CC   not original sequence. MCS.
CC   NM (pCB302b)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pK0-1)(pRK290)(pRK2013)
CC   BR (pCB267)
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pKO-1 SmaI 3980bp 312..312, ori/amp/galK
FT                   2. E. coli lpp gene, start of lacZ
FT                   3. linker SmaI-EcoRI 117bp
FT                   \ ttattgcccggggatggggagtaagcttctagagatcttccatacctacc
FT                   \ agttctccgcctgcaggtcgacggatccccagcttcaggtagagggtata
FT                   \ aaatgaaagggaattca
FT                   \ [alternative sequence for pCB302a:
FT                   \ ttattgcccggggatccgtcgacctgcaggcggagaactggtaggtatgg
FT                   \ aagatctctagaagcttcagcagagggtataaaatgaaagggaattca]
FT                   4. lambda, terminator t0
FT                   5. E. coli, lacZ gene
FT                   -> pCB302b 7000bp"
FT   misc_binding    0..0
FT                   /note="MCS SmaI-HindIII-XbaI-BglII-PstI-SalI-BamHI"
FT   CDS             0..0
FT                   /note="GEN E. coli lacZ gene"
FT   CDS             0..0
FT                   /note="ANT E. coli amp gene"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   terminator      0..0
FT                   /note="TER lambda t0"
FT   CDS             0..0
FT                   /note="ANT E. coli galK gene"
XX
SQ   Sequence 117 BP; 30 A; 27 C; 32 G; 28 T; 0 other;
     ttattgcccg gggatgggga gtaagcttct agagatcttc catacctacc agttctccgc
     ctgcaggtcg acggatcccc agcttcaggt agagggtata aaatgaaagg gaattca
//