back Return to this vector's summary.
ID   PCESMTRP   preliminary; circular DNA; SYN; 510 BP.
XX
AC   D10367; D00196;
XX
DT   23-JUL-1992 (Rel. 7, Created)
DT   01-APR-1995 (Rel. 11, Last updated, Version 1)
XX
DE   E. coli plasmid vector pCE-SMtrp - incomplete, acidic10K/Met-somato.
XX
KW   cloning vector; met-somatomedin C; somatomedin C; hormone;
KW   insulin-like growth factor; acidic 10K peptide; somatomedin C.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-510
RC   pCLaHtrp3t from alpha-human atrial natriuretic gene
RC   pCESMtrp from pLHSdMmtrp & oligo & pCLaHtrp3t
RA   Saito Y., Ishii Y., Niwa M., Ueda I.;
RT   "Direct expression of a synthetic somatomedin C gene in Escherichia
RT   coli by use of a two-cistron system";
RL   J. Biochem. 101:1281-1288(1987).
XX
RN   [2]
RC   pLHtrp from pTrpEB7 & LH gene
RC   pLHSdMmtrp from pLHtrp & oligo & pSdM1trp, somatomedin C gene
RC   pLHSdMwtrp from pLHSdMmtrp & oligo & pLHtrp
RA   Saito Y., Yamada H., Niwa M., Ueda I.;
RT   "Production and isolation of recombinant somatomedin C";
RL   J. Biochem. 101:123-134(1987).
XX
RN   [3]
RC   pTrpEB7 from pBR322 & trp promoter
RC   pSdM1trp from pBR322 & trp promoter & somatomedin C gene
RA   Niwa M., Sato S., Saito Y., Uchiyama F., Ono H., Yamashita M.,
RA   Kitaguchi T., Shiga Y., Notani J., Yamada H., Ishii Y., Ueda I.,
RA   Takagi Y.;
RT   "Chemical synthesis, cloning, and expression of genes for human
RT   somatomedin C (insulin-like growth factor I) and
RT   59Val-somatomedin C";
RL   Ann. N.Y. Acad. Sci. 469:31-52(1986).
XX
CC   plasmid pCLaHtrp3t HindIII-BamHI region
CC   plasmid pLHSdMmtrp Ava2-BamHI region
CC   Basic somatomedin C may be stabilized by forming a complex with an
CC   acidic polypeptide.  In the expression of the resulting genetic
CC   system, recombinant somatomedin C associated with the acidic
CC   polypeptide accumulated to high levels in the cells.
CC   NCBI gi: 220971
CC   NM (pCE-SMtrp)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pCLaHtrp3t)(pLHSdMmtrp)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. somatomedin C gene
FT                   -> pSdM1trp
FT                   1. tryptophan promoter
FT                   -> pTrpEB7
FT                   1. pTrpEB7 EcoRI-BamHI 4095bp, tryptophan promoter
FT                   2. LH gene EcoRI-BamHI 236bp
FT                   -> pLHtrp
FT                   1. pLHtrp large BamHI-HindIII
FT                   2. oligo HindIII-EcoRI 18bp
FT                   agcttgaagtaaaacatg
FT                   3. pSdM1trp EcoRI-BamHI 224bp, somatomedin C gene
FT                   -> pLHSdMmtrp
FT                   1. alpha-human atrial natriuretic gene
FT                   -> pCLaHtrp3t
FT                   1. pLHSdMmtrp BamHI-AvaII 215bp, somatomedin C gene
FT                   2. oligo AvaII-HindIII 23bp agcttgaggagaatcgataatgg
FT                   3. pCLaHtrp3t remove HindIII-BamHI,atrial natriuretic
FT                   -> pCESMtrp"
FT   mRNA            <1..>510
FT                   /note="RNA mRNA from pCE-SMtrp"
FT   CDS             8..292
FT                   /note="GEN E. coli acidic 10K polypeptide gene;
FT                   NCBI gi: 220972"
FT   CDS             292..507
FT                   /note="GEN E. coli met-somatomedin C polypeptide gene;
FT                   NCBI gi: 220973"
XX
SQ   Sequence 510 BP; 137 A; 114 C; 126 G; 133 T; 0 other;
     cgataaaatg ttctacttca acaaaccgac cggctatggc tccagctctc gtcgcgcacc
     gcagactggt atcgtagacg agggtggcga tgaattcatg tgttactgcc aggacccata
     tgtaaaagaa gcagaaaacc ttaagaaata ctttaatgca ggtcattcag atgtagcgga
     taatggaact cttttcttag gcattttgaa gaattggaaa gaggagagtg acagaaaaat
     aatgcagagc caaattgtct ccttttactt caagcttgag gagaatcgat aatgggtcct
     gaaactctgt gcggcgctga actggttgac gctctgcaat ttgtatgtgg tgatcgtggt
     ttctacttca acaaaccgac cggctatggc tccagctctc gtcgcgcacc gcagactggt
     atcgtagacg aatgctgttt tcgttcttgc gatctccgcc gtctggaaat gtactgtgct
     ccactgaagc cagcaaaatc cgcgtgatag
//