back Return to this vector's summary.
ID   PCGS966    preliminary; circular DNA; SYN; 19500 BP.
XX
AC   ATCC68371;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Saccharomyces/vertebrate/E.coli YAC vector pCGS966 - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   plasmid from YCp50 & yeast TRP1 gene
RC   plasmid2 from pYAC3 & plasmid
RC   [pCGS231 from GAL1 promoter]
RC   [pCGS822 from pCGS series]
RC   [pCGS829 from pCGS series]
RC   pCGS908 from plasmid2
RC   pCGS879 from pCGS908 & oligos
RC   pCGS922 from pCGS879 & oligos
RC   pCGS929 from pCGS822
RC   pCGS931 from pCGS829 & pCGS231, GAL1 promoter
RC   pCGS934 from pYACneo or pNN415 & pCGS931
RC   pCGS957 from pCGS934 & oligo
RC   pCGS963 from pCGS908 & pAYE56, tk gene
RC   pCGS966 from pCGS957 & pCGS963
RA   Smith D.R., Smyth A.P., Moir D.T.;
RT   "Amplification of large artificial chromosomes";
RL   Proc. Natl. Acad. Sci. U.S.A. 87:8242-8246(1990).
XX
RN   [2]
RC   pAYE28 from pBR325 & YEp13
RC   pAYE39 from pAYE28 & yeast 2 micron
RC   pAYE81 from pTK1, HSV-1 tk gene
RC   pAYE56 from pAYE39 & pAYE81
RA   Zealey G.R., Goodey A.R., Piggott J.R., Watson M.E.,
RA   Cafferkey R.C., Doel S.M., Carter B.L., Wheals A.E.;
RT   "Amplification of plasmid copy number by thymidine kinase
RT   expression in Saccharomyces cerevisiae";
RL   Mol. Gen. Genet. 211:155-159(1988).
XX
RN   [3]
RC   pTK1 from HSV-1 tk gene
RA   Wilkie N.M., Eglin R.P., Sanders P.G., Clements J.B.;
RT   "The association of Herpes simplex virus with squamous carcinoma of
RT   the cervix and studies of the virus thymidine kinase gene";
RL   Proc. R. Soc. Lond. Biol. 210:411-421(1980).
XX
CC   This YAC cloning vector has a conditional centromere for copy number
CC   amplification of yeast artificial chromosomes, T3 and T7 promoters,
CC   restriction sites for inverse PCR rescue, and a replication origin and
CC   markers functional in mammalian cells.
CC   Restriction sites available for inverse PCR rescue include MboI
CC   (flanking EcoRI by 107 and 77 bp), RsaI (flanking EcoRI by 297 and 352
CC   bp), and TaqI (flanking EcoRI by 508 and 869 bp).
CC   Induced transcription from a GAL1 promoter inactivates the centromere
CC   and increases copy number.  Additional amplification results from
CC   growth in media containing methotrexate, sulfanilamide and thymidine.
CC   This YAC cloning vector has bacterial replication origins and
CC   selectable markers on both arms to permit rescue of end subclones from
CC   each end in E.coli.
CC   Restriction digests of the clone give the following sizes (kb):
CC   BamHI--18.0,1.8; EcoRI--20.0; HindIII--5.4, 4.5, 3.3, 2.7, 1.7, 1.4.
CC   (ATCC staff)
CC   Medium is 1227 LB plus ampicillin.
CC   NM (pCGS966)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (yeast artificial chromosome)
CC   SP (ATCC)
CC   HO (E.coli XL-1)(Saccharomyces cerevisiae)(vertebrate cells)(E.coli)
CC   HO (Saccharomyces cerevisiae CGY2516 [ATCC 74013])
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA ()
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. YCp50 BamHI 7950bp 379..379
FT                   2. yeast BamHI-BamHI 8000bp, TRP1 gene
FT                   -> plasmid 16000bp
FT                   1. pYAC3 remove small AatII-XbaI 261bp,
FT                   \ pYAC4 8940..9201/11500bp
FT                   2. plasmid AatII-XbaI 1300bp 7881..?, pBR322 to TRP1
FT                   -> plasmid2 12800bp
FT                   1. plasmid2 EcoRI-EcoRI 10000bp, pYAC4 555 & YCp50 2
FT                   fill in:fill in
FT                   2. plasmid2 EcoRI-EcoRV 700bp, promoter
FT                   fill in
FT                   -> pCGS908 11000bp
FT                   1. oligo CC-ClaI-T7 prom-SnaBI-T3 prom-DraIII 64bp
FT                   \ ccccatcgattaatacgactcactatagggatacgtatccctttagtgag
FT                   \ ggttaattcacaca
FT                   2. pCGS908 DraIII-AatII 2400bp
FT                   3. oligo AatII-SalI-BamHI-CC 21bp
FT                   \ cgtcgacgtgtgtggatcccc
FT                   -> fragment 2500bp
FT                   1. fragment ClaI-BamHI 2400bp
FT                   2. pCGS908 BamHI-ClaI 6500bp
FT                   -> pCGS879 8900bp
FT                   1. pCGS879 AatII-AatII 5400bp
FT                   mung bean nuclease
FT                   2. pCGS879 SnaBI-SnaBI 4000bp
FT                   -> pCGS922 9400bp [unique SnaBI]
FT                   1. pCGS922 EcoRV-SalI
FT                   fill in:fill in
FT                   -> pCGS929 [one TRP, ARS1]
FT                   1. yeast GAL1 promoter
FT                   -> pCGS231
FT                   1. pCGS929 HpaI
FT                   2. pCGS231 SalI-RsaI 451bp, GAL1 promoter
FT                   fill in:
FT                   -> pCGS931
FT                   1. pYACneo SalI-XhoI 10128bp 403..10531, centromere
FT                   \ [9700bp]
FT                   fill in with CT:
FT                   2. pCGS931 BamHI-XhoI 6500bp, GAL1 promoter
FT                   fill in with AG:
FT                   -> pCGS934 16200bp
FT                   1. pCGS934 DraIII-ClaI 16100bp
FT                   2. oligo ClaI-SnaBI-T3-EcoRI-T7-SnaBI-DraIII 63bp
FT                   \ cgctacgtaaattaaccctcactaaagggaattccctatagtgagtcgta
FT                   \ ttattacgtaaca
FT                   -> pCGS957 16200bp
FT                   1. pBR325 PstI 5994bp 3612..3612, amp gene
FT                   2. YEp13 PstI-PstI 4043bp, LEU2 gene
FT                   -> pAYE28 10037bp
FT                   1. pAYE28 NdeI 10037bp 2299..2299
FT                   2. yeast 2 micron NdeI 6318bp 341..341
FT                   -> pAYE39 16355bp
FT                   1. HSV-1, tk gene/#X14112
FT                   -> pTK1
FT                   1. pTK1, HSV-1 tk gene/#X14112
FT                   -> pAYE81 13600bp
FT                   1. pAYE81 BamHI-BamHI 4300bp, HSV-1 tk gene/#X14112
FT                   2. pAYE39 BamHI 16355bp, pBR325 376..376
FT                   -> pAYE56 20700bp
FT                   1. pCGS908 AatII 11000bp
FT                   T4 DNA polymerase
FT                   2. pAYE56 EcoRI-EcoRI 3100bp, tk gene/#X14112
FT                   mung bean nuclease
FT                   T4 DNA polymerase:T4 DNA polymerase
FT                   -> pCGS963 14100bp
FT                   1. pCGS957 Bsu36I-PvuI 14600bp
FT                   2. pCGS963 EcoRI 14100bp, next to tk gene
FT                   fill in
FT                   Bsu36I-PvuI 5000bp
FT                   -> pCGS966 19500bp"
FT   misc_binding    0..0
FT                   /note="SIT unique EcoRI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   rep_origin      0..0
FT                   /note="ORI SV40"
FT   rep_origin      0..0
FT                   /note="ORI yeast ARS1"
FT   misc_feature    0..0
FT                   /note="yeast centromere CEN4"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   CDS             0..0
FT                   /note="ANT yeast TRP1 gene"
FT   CDS             0..0
FT                   /note="ANT yeast URA3 gene"
FT   CDS             0..0
FT                   /note="ANT mammal methotrexate resistance gene (mtx)"
XX
SQ   Sequence 1 BP; 0 A; 0 C; 0 G; 0 T; 1 other;
     n
//