back Return to this vector's summary.
ID   PCIT30     preliminary; circular DNA; SYN; 10400 BP.
XX
AC   IG5074;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pCIT30 - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pCIT20 from pMON754 & pIC20R
RC   pCIT23 from pMON200 & pMON754
RC   pCIT25 from pCIT23 & pCOS0
RC   pCIT30 from pCIT25 & oligo
RC   pCIT98 from pMON721 & pCOS0
RC   pCIT103, pCIT104 from pCIT98 & oligo
RC   pCIT97 from pMON200 & pCOS0
RC   pCIT101, pCIT102 from pCIT97 & oligo
RA   Ma H., Yanofsky M.F., Klee H.J., Bowman J.L., Meyerowitz E.M.;
RT   "Vectors for plant transformation and cosmid libraries";
RL   Gene 117:161-167(1992).
XX
RN   [2]
RC   pMON200 from pTiA6 & linker & pBR322 & pTiT37 & Tn7
RC   pMON505 from pMON200 & linker & oriV & trfA gene & pTJS75 & pBR322
RC   pMON237 from pMON200 & linker & M13mp8 & pOS-1, CaMV 19S promoter
RC   pMON316 from pMON200 & pBR322 & M13mp8 & pOS-1, CaMV 35S promoter
RC   pMON526 from pMON505
RC   pMON530 from pMON526 & pMON316
RC   pMON408 from pMON316 & M13mp8 & pLG83 & pLG89, hyg gene
RC   pMON410 from pMON530 & M13mp8 & pLG83 & pLG89, hyg gene
RC   pMON321 from pMON237 & M13mp8 & pDHFR11, mtx gene
RC   pMON806 from pMON505 & pDHFR11, mtx gene
RC   [pMON754 from RK2 & pTiT37 & T-DNA & kan gene & spec gene]
RA   Rogers S.G., Klee H.J., Horsch R.B., Fraley R.T.;
RT   "Improved Vectors for plant transformation: expression cassette
RT   vectors and new selectable markers";
RL   Meth. Enzymol. 153:253-277(1987).
XX
RN   [3]
RC   pMON721 from RK2 & Ti plasmid
RA   Klee H.J., Muskopf Y.;
RT   ;
RL   Unpublished (1992).
XX
RN   [4]
RC   [pLAFRI from Agrobacterium]
RC   pLAFRI::linker from pLAFRI & linker
RC   pKC710, pKC720 from pKC7 & pLAFRI::linker
RC   pSUP101::pBR325 from pSUP101 & linker & pBR325
RC   pSUP101::pBR325::pKC710 from pSUP101::pBR325 & pKC710
RC   pSUP101::pBR325::pKC720 from pSUP101::pBR325 & pKC720
RC   pLGV23neo::pAGV40 from pLGV23neo & pAGV40
RC   pHC79::pLGV23neo::pAGV40 from pHC79 & pLGV23neo::pAGV40
RC   pHC79::pLGV23neo::pAGV40::piAN7 from pHC79::pLGV23neo::pAGV40 & piAN7
RC   plasmid1 from pHC79::pLGV23neo::pAGV40::piAN7 & pKm109/2
RC   from pSUP101::pBR325::pKC710 & pTiC58
RC   plasmid2 from pHC79 & pGV0153
RC   pPCV001, pPCV002 from plasmid1 & plasmid2
RC   pPCV011 from pPCV001 & pSUP401, cat gene
RC   pPCV021 from pPCV002 & pSUP401, cat gene
RC   pRK011 from pPCV011 & pCT153.1
RC   pRK021 from pPCV021 & pCT153.1
RC   pPCV012 from pBR322 & pRK011
RC   pPCV022 from pBR322 & pRK021
RC   pHC79::pBR325 from pHC79 & pBR325
RC   pPCV003 from pRK011 & pHC79::pBR325
RC   pPCV121 from pPCV012 & pAGV10
RC   pPCV123 from pPCV012 & pAGV30
RC   pPCV124 from pPCV012 & pAGV40
RC   pPCV221 from pPCV022 & pAGV10
RC   pPCV223 from pPCV022 & pAGV30
RC   pPCV224 from pPCV022 & pAGV40
RC   pPCV310 from pPCV003 & pAGV10
RC   pPCV330 from pPCV003 & pAGV30
RC   pPCV340 from pPCV003 & pAGV40
RC   pPCV311 from pPCV310 & pGV354
RC   pPCV331 from pPCV330 & pGV354
RC   pPCV341 from pPCV340 & pGV354
RC   pGV357Gm1 from pGV357 & p45-2, gent gene
RC   pTid37 from pGV357Gm1 & pGV316
RC   pMP90 from pTid37 & pGV2201
RC   pRKGV20 from pGV357 & pRK2013 & linker
RC   pMP90RK from pRKGV20 & pMP90
RA   Koncz C., Schell J.;
RT   "The promoter of T1-DNA gene 5 controls the tissue-specific
RT   expression of chimaeric gene carried by a novel type of
RT   Agrobacterium binary vector";
RL   Mol. Gen. Genet. 204:383-396(1986).
XX
RN   [5]
RC   p45-2 from gent gene
RA   Kagan S.A.;
RT   ;
RL   Unpublished (1986).
XX
RN   [6]
RC   pGJ28 from ColE1 & RK2, mob gene
RA   Finnegan J., Sherrat D.;
RT   "Plasmid ColE1 conjugal mobility: the nature of bom, a region
RT   required in cis for transfer";
RL   Mol. Gen. Genet. 185:344-351(1982).
XX
CC   MCS. oligonucleotide linker.
CC   NM (pCIT30)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pMON754 from pBR322 & RK2)(pTiT37)(pIC-20R)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. lambda
FT                   -> pCOS0
FT                   1. linker EcoRI-HindIII 39bp
FT                   \ gaattcatcgatatctagatctcgagctcgcgaaagctt
FT                   2. pTiA6 HindIII-BglII 1600bp 3395..1618, Ti LIH
FT                   :Klenow
FT                   3. pBR322 PvuII-PvuI 1672bp 2067..3739, ori
FT                   4. pTiT37 PvuI-ClaI 2400bp, nos gene/right border
FT                   5. Tn7 ClaI- 2200bp 560..883, dhfr gene
FT                   6. Tn7 -EcoRI 1..1614, spec/strep gene/#X03043
FT                   :Klenow
FT                   7. linker EcoRI-ClaI 20bp gaattaattcccgatcgatc
FT                   8. pTiT37 ClaI-Sau3A 2102..1847, nos gene
FT                   9. linker Sau3A-SmaI 13bp ggggatccggggg
FT                   10. Tn5 Sau3A/MboI-SmaI 998bp 1521..2519,
FT                   \ neo gene/complement
FT                   11. linker Sau3A-PstI 15bp gtctaggatctgcag
FT                   12. pTiT37 PstI-BclI 584..284, nos promoter
FT                   13. linker BclI-EcoRI 15bp tgatccggggaattc
FT                   -> pMON200 9489 bp
FT                   1. pTiT37, nos gene/right border
FT                   2. pBR322 4361bp, ori
FT                   3. RK2, ori
FT                   4. Tn7, spec gene/#X03043
FT                   5. E. coli 1142bp, hyg gene
FT                   -> pMON754 11800bp
FT                   1. pMON754 HindIII 11800bp, pBR322 30..30
FT                   fill in
FT                   SalI 11800bp, pBR322 652..652
FT                   fill in
FT                   StuI 11800bp, between spec gene and hyg gene
FT                   2. pIC20R HaeII-HaeII 477bp 3..480, MCS/lacZ gene
FT                   -> pCIT20 12000bp
FT                   1. pMON200 remove HindIII-StuI 1950bp,kan gene/7500bp
FT                   2. pMON754 HindIII-StuI 2400bp, hyg gene
FT                   -> pCIT23 9900bp
FT                   1. pCIT23 HindIII 9900bp, pBR322 30..30
FT                   Klenow
FT                   2. pCOS0 HincII-HincII 403bp 48299..48502..200,
FT                   \ lambda cos
FT                   -> pCIT25 10300bp
FT                   1. pCIT25 StuI 10300bp, at beginning of hyg gene
FT                   2. oligo 65bp gacggcccccccggcctaatacgactcactatagatctat
FT                   \ agtgtcacctaaatgcggccgcgtc
FT                   -> pCIT30 10400bp [unique SfiI, BglII, NotI]"
FT   misc_binding    0..0
FT                   /note="MCS SfiI-T7 promoter-BglII-Sp6 promoter-NotI"
FT   promoter        0..0
FT                   /note="PRO E. coli phage T7"
FT   promoter        0..0
FT                   /note="PRO E. coli phage Sp6"
FT   CDS             0..0
FT                   /note="ANT E. coli hyg gene"
FT   rep_origin      0..0
FT                   /note="ORI lambda cos"
FT   CDS             0..0
FT                   /note="GEN Agrobacterium Ti LIH"
FT   misc_binding    0..0
FT                   /note="MCS SfiI-T7 promoter-BglII-Sp6 promoter-NotI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   misc_feature    0..0
FT                   /note="Agrobacterium Ti right border"
FT   CDS             0..0
FT                   /note="GEN Agrobacterium nos gene"
FT   CDS             0..0
FT                   /note="ANT E. coli streptomycin/spectinomycin gene"
XX
SQ   Sequence 65 BP; 15 A; 23 C; 14 G; 13 T; 0 other;
     gacggccccc ccggcctaat acgactcact atagatctat agtgtcacct aaatgcggcc
     gcgtc
//