back Return to this vector's summary.
ID   PCWRSVNHIV preliminary; circular DNA; SYN; 64 BP.
XX
AC   IG5183;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pCWRSVN-HIVA - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pCWRSVN-HIVA from pAV1 & RSV LTR & linker & SV40 early prom & neo gene
RC   pSMMH4i from SIV
RA   Chatterjee S., Johnson P.R., Wong K.K.;
RT   "Dual-target inhibition of HIV-1 in vitro by means of an
RT   adeno-associated virus antisense vector";
RL   Science 258:1485-1488(1992).
XX
RN   [2]
RC   [lambda J1 from lambda]
RC   lambda HXB2, lambda HXB3 from lambda J1 & HTLV-III/LAV or HIV
RC   pSP65gpt from pSP65 & pSV2-gpt
RC   pHXB2, pHXB2gpt from pSP65gpt & lambda HXB2
RC   lambda BH10 from lambda gtWES.lambdaB & HTLV-III/LAV or HIV
RC   pBH10 from pSP64 & lambda BH10
RC   pHXB3 from pSP62 & lambda HXB3
RC   pHXB2/3gpt from pHXB2gpt & pHXB3
RA   Ratner L., Fisher A., Jagodzinski L.L., Mitsuya H., Liou R.S.,
RA   Gallo R.C., Wong-Staal F.;
RT   "Complete nucleotide sequences of functional clones of the AIDS
RT   virus";
RL   AIDS Res. Hum. Retroviruses 3:57-69(1987).
XX
RN   [3]
RC   pSM501, pSM503, pSM504 from pBR322 & AAV
RC   pSM620, pSM621 from pSM501
RA   Samulski R.J., Berns K.I., Tan M., Muzyczka N.;
RT   "Cloning of adeno-associated virus into pBR322: rescue of intact
RT   virus from the recombinant plasmid in human cells";
RL   Proc. Natl. Acad. Sci. U.S.A. 79:2077-2081(1982).
XX
RN   [4]
RC   pBenn7 from pB2, HIV LTR
RC   pBenn7-1 from pBenn7
RC   pBennCAT from pBenn7-1 & pA10CAT2, cat gene
RC   pSR from pNL4-3, HIV tat gene
RC   pAR(tat) from pSR
RA   Gendelman H.E., Phelps W., Feigenbaum L., Ostrove J.M., Adachi A.,
RA   Howley P.M., Khoury G., Ginsberg H.S., Martin M.A.;
RT   "Trans-activation of the human immunodeficiency virus long
RT   terminal repeat sequence by DNA viruses";
RL   Proc. Natl. Acad. Sci. U.S.A. 83:9759-9763(1986).
XX
RN   [5]
RC   pB2 from HIV
RA   Benn S., Rutledge R., Folks T., Gold J., Baker L., McCormick J.,
RA   Feorino P., Piot P., Quinn T., Martin M.A.;
RT   "Genomic heterogeneity of AIDS retroviral isolates from North
RT   America and Zaire";
RL   Science 230:949-951(1985).
XX
RN   [6]
RC   pEcoRI-C from HSV
RA   Goldin A.L., Sandri-Goldin R.M., Levine M., Glorioso J.C.;
RT   "Cloning of herpes simplex virus type 1 sequences representing the
RT   whole genome";
RL   J. Virol. 38:50-58(1981).
XX
RN   [7]
RC   pEcoRI-A from varicella-zoster virus VZV
RA   Straus S.E., Owens J., Ruyechan W., Takiff H.E., Casey T.A.,
RA   Vande Woude G.F., Hay J.;
RT   "Molecular cloning and physical mapping of varicella-zoster virus
RT   DNA";
RL   Proc. Natl. Acad. Sci. U.S.A. 79:993-997(1982).
XX
CC   MCS. oligonucleotide linker.
CC   NM (pCWRSVN-HIVA)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pTAAV)(HIV-1)(pAV1)(SV40)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. AAV
FT                   -> pAV1
FT                   1. pAV1 remove 3844bp 190..4034
FT                   2. oligo SalI-XbaI 64bp
FT                   \ ttgaggcttaagcaatgggttccctagttagccagagagctcccaggctc
FT                   \ agatctggtctaat
FT                   3. RSV, LTR
FT                   4. Tn5, neo gene
FT                   5. SV40 HindIII-PvuII 344bp 5172..5243..273,
FT                   \  early promoter
FT                   -> pCWRSVN-HIVA"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 64 BP; 15 A; 15 C; 17 G; 17 T; 0 other;
     ttgaggctta agcaatgggt tccctagtta gccagagagc tcccaggctc agatctggtc
     taat
//