back Return to this vector's summary.
ID   PET3A      preliminary; circular DNA; SYN; 1 BP.
AC   IG2008;
DT   01-JUN-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
DE   E. coli plasmid vector pET3a - complete.
KW   cloning vector.
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
RN   [1]
RC   pAR939 from pBR322 & terminator Tphi
RC   pAR1959 from pBR322 & phi10 promoter
RC   pAR2067 from pBR322
RC   pAR3433 from pBR322 & R1.1 site
RC   pAR3435 from pAR3433
RC   pAR2516 from pAR939
RC   pAR1032 from pAR939
RC   pET-1 or pAR2019 from pAR1959
RC   pET-2 or pAR2305 from pET-1
RC   pET-3 or pAR2529 from pET-2 & pAR2516
RC   pET-4 or pAR3444 from pET-2 & pAR3435
RC   pET-5 or pAR2192 from pET-1 & oligo
RC   pET-6 or pAR2369 from pET-2 & pAR1959 & oligo
RC   pET-7 or pAR2563 from pET-6
RC   pAR2084, pAR2078, pAR2075 from T7 & pAR2067
RC   pET-1a or pAR2098, pET-2a or pAR2113 from pAR2084
RC   pET-1b or pAR2093, pET-2b or pAR2106 from pAR2078
RC   pET-1c or pAR2120, pET-2c or pAR2156 from pAR2075
RC   pET-3a or pAR3040 from pET-2a & pAR1032
RC   pET-3b or pAR3039 from pET-2b & pAR1032
RC   pET-3c or pAR3038 from pET-2c & pAR1032
RC   pET-4a or pAR3445 from pET-2a & pAR3435
RC   pET-4b or pAR3446 from pET-2b & pAR3435
RC   pET-4c or pAR3447 from pET-2c & pAR3435
RC   pET-5a or pAR3406 from pET-2a & pET-5
RC   pET-5b or pAR3405 from pET-2b & pET-5
RC   pET-5c or pAR3404 from pET-2c & pET-5
RC   pET-3xa or pAR3129 from pET-2a & pAR1032
RC   pET-3xb or pAR3131 from pET-2b & pAR1032
RC   pET-3xc or pAR3130 from pET-2c & pAR1032
RA   Rosenberg A.H., Lade B.N., Chui D.S., Lin S.W., Dunn J.J.,
RA   Studier F.W.;
RT   "Vectors for selective expression of cloned DNAs by T7 RNA
RT   polymerase";
RL   Gene 56:125-135(1987).
CC   NM (pET3a)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   HO (E.coli)
CC   CP ()
CC   FN (expression)
CC   SE ()
CC   PA (pBR322)
CC   BR ()
CC   OF ()
CC   OR ()
FH   Key             Location/Qualifiers
FT   misc_feature    0..0
FT                   /note="1. pBR322 BamHI 4361bp 376..376, tet
FT                   2. T7 HhaI-HhaI 122bp 24106..24228, -104 to +19
FT                   \ ctgctaacaaagcc
FT                   \ cgaaaggaagctgagttggctgctgccaccgctgagcaataactagcata
FT                   \ accccttggggcctctaaacgggtcttgaggggttttttgctgaaaggag
FT                   \ gaactata, Tphi term
FT                   -> pAR939 4483bp
FT                   1. pAR939 BamHI 4483bp, T7 3' gene 10
FT                   EcoRV linker 6bp gatatc
FT                   -> pAR1032 4489bp
FT                   1. pBR322 NdeI 4361bp 2297..2297
FT                   Klenow
FT                   -> pAR2067 4361bp [unique NdeI at gene 10 init]
FT                   1. T7 TaqI-RsaI 118bp 22880..22998, -23 to +96 phi10
FT                   \ cgaaattaatacgactcactatagggagaccacaacggtt
FT                   \ tccctctagaaataattttgtttaactttaagaaggagatatacatatgg
FT                   \ ctagcatgactggtggac
FT                   BamHI linker 10bp cgggatcccg:BamHI linker 12bp
FT                   \ cgcggatccgcg
FT                   2. pAR2067 BamHI 4361bp 376..376, tet
FT                   -> pAR2084 4501bp
FT                   1. pAR2084 BamHI 4501bp
FT                   Klenow
FT                   BglII linker 8bp gagatctc
FT                   -> pET-2a 4500bp
FT                   1. pET-2a PstI-BamHI 1400bp, phi10
FT                   2. pAR1032 BamHI-PstI 3238bp, pBR322 376..3614
FT                   -> pET-3a 4600bp"
FT   misc_binding    23..23
FT                   /note="SIT unique ClaI"
FT   misc_binding    29..29
FT                   /note="SIT unique HindIII"
FT   promoter        complement(185..461)
FT                   /note="PRO bacteriophage T7"
FT   promoter        185..461
FT                   /note="MCS"
FT   terminator      194..316
FT                   /note="PRO bacteriophage T7 phi10 gene"
FT   promoter        403..427
FT                   /note="PRO E. coli lac operator"
FT   misc_feature    429..429
FT                   /note="bacteriophage T7 transcription initiation
FT                   site"
FT   promoter        430..446
FT                   /note="PRO bacteriophage T7 phi10 gene"
FT   misc_binding    461..461
FT                   /note="SIT unique BglI"
FT   misc_binding    654..654
FT                   /note="SIT unique SphI"
FT   misc_binding    714..714
FT                   /note="SIT unique EcoNI"
FT   CDS             833..1915
FT                   /note="REP E. coli lacIq gene"
FT   misc_binding    904..904
FT                   /note="SIT unique DrdII"
FT   misc_binding    1183..1183
FT                   /note="SIT unique MluI"
FT   misc_binding    1197..1197
FT                   /note="SIT unique BclI"
FT   misc_binding    1364..1364
FT                   /note="SIT unique BstEII"
FT   misc_binding    1390..1390
FT                   /note="SIT unique ApaI"
FT   misc_binding    1594..1594
FT                   /note="SIT unique BssHII"
FT   misc_binding    2024..2024
FT                   /note="SIT unique PshAI"
FT   misc_binding    2251..2251
FT                   /note="SIT unique EagI"
FT   misc_binding    2284..2284
FT                   /note="SIT unique NruI"
FT   misc_binding    2375..2375
FT                   /note="SIT unique BspMI"
FT   misc_binding    2665..2665
FT                   /note="SIT unique BsmI"
FT   misc_binding    2737..2737
FT                   /note="SIT unique AvaI"
FT   misc_binding    2756..2756
FT                   /note="SIT unique MscI"
FT   misc_binding    2892..2892
FT                   /note="SIT unique Bpu10I"
FT   CDS             >3000..<3558
FT                   /note="REP E. coli ROP gene"
FT   misc_binding    3531..3531
FT                   /note="SIT unique Tth111I"
FT   misc_binding    3539..3539
FT                   /note="SIT unique BsaAI"
FT   misc_binding    3558..3558
FT                   /note="SIT unique AccI"
FT   misc_binding    3666..3666
FT                   /note="SIT unique SapI"
FT   rep_origin      complement(>3666..<4400)
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   rep_origin      complement(3850..3850)
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322) start"
FT   misc_binding    4200..4200
FT                   /note="SIT unique AlwNI"
FT   CDS             complement(4619..5469)
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   misc_binding    4677..4677
FT                   /note="SIT unique Eam1105I"
FT   misc_binding    4749..4749
FT                   /note="SIT unique BsaI"
FT   misc_binding    4923..4923
FT                   /note="SIT unique PstI"
FT   misc_binding    5049..5049
FT                   /note="SIT unique PvuI"
FT   misc_binding    5160..5160
FT                   /note="SIT unique ScaI"
FT   misc_binding    5484..5484
FT                   /note="SIT unique SspI"
FT   misc_binding    5600..5600
FT                   /note="SIT unique AatII"
FT   misc_binding    5675..5675
FT                   /note="SIT unique EcoRI"
SQ   Sequence 1 BP; 0 A; 0 C; 0 G; 0 T; 1 other;