back Return to this vector's summary.
ID   PET3AP     preliminary; circular DNA; SYN; 41 BP.
XX
AC   IG5162;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pET3ap - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pET3ap from pET-3a & linker
RC   pET3bp from pET-3b & linker
RC   pET3cp from pET-3c & linker
RC   pET3ap* from pET3ap
RC   pET3bp* from pET3bp
RC   pET3cp* from pET3cp
RA   Mackett M., Littler E., Michael R., Gartland M., Arrand J.R.;
RT   "Vectors with multiple insertion sites for expression of cloned
RT   genes by T7 RNA polymerase: expression of a peptide from EBV
RT   thymidine kinase (TK)";
RL   Nucleic Acids Res. 18:1082-1082(1990).
XX
CC   MCS. oligonucleotide linker.
CC   NM (pET3ap)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pET3 series from pBR322)
CC   BR (pET3bp)(pET3cp)
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pET-3a EcoRI, pBR322 part
FT                   fill in
FT                   BamHI, MCS
FT                   2. linker StuI-BamHI-EcoRI-SmaI 41bp
FT                   \ caaatgggtcgcggatcaggcctggatccgaattccccggg
FT                   -> pET3ap"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 41 BP; 8 A; 12 C; 14 G; 7 T; 0 other;
     caaatgggtc gcggatcagg cctggatccg aattccccgg g
//