back Return to this vector's summary.
ID   PEV40      preliminary; circular DNA; SYN; 2800 BP.
XX
AC   IG6004;
XX
DT   02-NOV-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pEV40 - incomplete, MCS.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pEV40a, pEV40b, pEV40c from pEV39a & oligo
RC   pEV41a, pEV41b, pEV41c from pEV40a
RA   Pohlner J., Kraemer J., Meyer T.F.;
RT   "A plasmid system for high-level expression and in vitro processing
RT   of recombinant proteins";
RL   Gene 130:121-126(1993).
XX
RN   [2]
RC   pEX1000 from pEx31 & pIP100
RC   pEX1100 from pEx31 & pIP100
RC   pEV39, pEV39a, pEV39b, pEV39c from pBR322 & lambda & phage MS2 & His6
RC   pTK66, pTK67 from pEV39
RA   Pohlner J., Klauser T., Kuttler E., Halter R.;
RT   "Sequence-specific cleavage of protein fusions using a recombinant
RT   Neisseria type 2 IgA protease";
RL   Biotechnology 10:799-804(1992).
XX
RN   [3]
RC   pIP100 from N.gonorrheae IgA protease gene
RA   Meyer T.F., Halter R., Pohlner J.;
RT   "Mechanism of extracellular secretion of an IgA protease by
RT   gram-negative host cells";
RL   Recent Advances in Mucosal Immunology 216B:1271-1281(1987).
RL   McGhee J.R., Mestecky J., Ogra P.L., Bienenstock J., eds.,
RL   Plenum, New York.
XX
CC   NM (pEV40)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pEV39)(pBR322)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 NdeI-? 1883bp 2297..4180,ori/amp gene
FT                   \ SspI is at 4171
FT                   2. lambda, pL promoter
FT                   3. phage MS2 17bp gacaaatccttgtcatc, AA1 to AA97
FT                   \ polymerase gene
FT                   4. IgA protease cleavage site cassette 25bp
FT                   \ tactccagctccacgtccaccaaca
FT                   5. oligo 35bp cccgggaattctgcagcatcgacggatccaagctt, MCS
FT                   6. phage fd 17bp gactgactgactgagtc, terminator
FT                   -> pEV39a 3100bp
FT                   1. pEV39a EcoNI-SmaI 2530bp, no MS2-Pol AA12 to 97
FT                   2. pEV39a 262bp
FT                   Klenow
FT                   EcoNI-EcoNI, his6
FT                   -> pEV40a 2800bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 94 BP; 24 A; 32 C; 18 G; 20 T; 0 other;
     gacaaatcct tgtcatctac tccagctcca cgtccaccaa cacccgggaa ttctgcagca
     tcgacggatc caagcttgac tgactgactg agtc
//