back Return to this vector's summary.
ID   PEXT2      preliminary; circular DNA; SYN; 1 BP.
XX
AC   IG6001;
XX
DT   02-NOV-1993 (Rel. 7, Created)
DT   01-APR-1995 (Rel. 11, Last updated, Version 1)
XX
DE   E. coli plasmid vector pEXT2 - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pUC-BglII from pUC13 & BglII linker
RC   pSV2A/deltaL from pSV2A/L-Adelta5'
RC   pUCSV2 from pSV2A/deltaL & pUC-BglII
RC   pEXT1 from pUC13 & rat alpha2 macroglobulin gene & pUCSV2
RC   pEXT2 from pEXT1 & oligo
RA   Ozawa N., Kano T., Taga C., Hattori M., Sakaki Y., Suzuki H.;
RT   "An exon-trapping system with a newly constructed trapping vector
RT   pEXT2; its application to the proximal region of the human
RT   chromosome 21 long arm";
RL   FEBS Lett. 325:303-308(1993).
XX
RN   [2]
RC   lambda RA2MG-73 from lambda & rat alpha2 macroglobulin gene
RC   from pBR328 & lambda RA2MG-73
RA   Northemann W., Shiels B.R., Braciak T.A., Hanson R.W., Heinrich P.C.,
RA   Fey G.H.;
RT   "Structure and acute-phase regulation of the rat alpha
RT   2-macroglobulin gene";
RL   Biochemistry 27:9194-9203(1988).
XX
CC   NM (pEXT2)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)(exon trapping)
CC   SE ()
CC   PA (pEXT1, from pUC13 and rat alpha2 macroglobulin gene and pUCSV2)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pUC13 PvuII-PvuII 2400bp
FT                   2. BglII linker
FT                   -> pUC-BglII
FT                   1. pSV2A/L-Adelta5' XbaI
FT                   -> pSV2A/deltaL
FT                   1. pSV2A/deltaL HindIII
FT                   blunt end
FT                   BamHI-BamHI, SV40 early promoter/luc gene/SV40polyA
FT                   2. pUC-BglII BglII
FT                   -> pUCSV2
FT                   1. pUC13 remove short EcoRI-BamHI
FT                   fill in:fill in
FT                   2. rat alpha2 macroglobulin gene EcoRI-StuI 2300bp
FT                   -> plasmid
FT                   1. plasmid BamHI
FT                   blunt end
FT                   BglII, 4541..4541
FT                   XbaI linker
FT                   XbaI-XbaI, rat alpha2 macroglobulin gene
FT                   2. pUCSV2 XbaI
FT                   -> pEXT1
FT                   1. pEXT1 remove short EcoRV-PstI
FT                   2. oligo atcaagcttggatccggaattcacggccgctgca
FT                   -> pEXT2"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 1 BP; 0 A; 0 C; 0 G; 0 T; 1 other;
     n
//