back Return to this vector's summary.
ID   PFL61      preliminary; circular DNA; SYN; 5425 BP.
XX
AC   X62909; ATCC77215;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Saccharomyces/E.coli plasmid vector pFL61 - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pFL61 from pFL60 & linker
RA   Minet M., Dufour M.E., Lacroute F.;
RT   "Complementation of Saccharomyces cerevisiae auxotrophic mutants
RT   by Arabidopsis thaliana cDNAs";
RL   Plant J. 2:417-422(1992).
XX
RN   [2]
RC   plasmid from pUC19 & linkers
RC   pFL34 from plasmid & URA3 gene
RC   pFL40 from pFL34 & yeast 2 micron ori
RC   pFL60 from pFL40 & PGK promoter/terminator & linker
RA   Minet M., Lacroute F.;
RT   "Cloning and sequencing of a human cDNA coding for a multifunctional
RT   polypeptide of the purine pathway by complementation of the ade2-101
RT   mutant in Saccharomyces cerevisiae";
RL   Curr. Genet. 18:287-291(1990).
XX
CC   A YE-type shuttle expression vector. (personal communication)
CC   The order of the major features in this plasmid is:EcoRI/MCS/XbaI -
CC   pGK5' - NotI - BstXI - BstXI - NotI - pGK3' - URA3 -  2 micron -
CC   pMB1 ori - AmpR. (personal communication)
CC   Restriction digests of the clone give the following sizes (kb):
CC   BamHI--5.4; BglII--4.3, 1.1; ClaI--4.9, 0.5. (ATCC staff)
CC   Medium is 1227 LB plus ampicillin.
CC   NM (pFL61)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli HB101)(Saccharomyces cerevisiae)(E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA ()
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pFL34 ClaI 3799bp 1856..1856
FT                   2. yeast 2 micron B form MstI-MstI 500bp
FT                   \ 3516..3942 & 703..629, ori
FT                   \ UL = 3239bp 703..3942 US = 3079bp 3942..6318..703 A
FT                   \ UL = 3239bp 703..3942 US = 3079bp 703..6318..3942 B
FT                   -> pFL40 4299bp [AccI, HincII, SmaI, XbaI: not unique]
FT                   1. pFL40 remove AccI-HindIII 17bp 431..448, 4282bp
FT                   2. PGK promoter/terminator ClaI-HindIII 1160bp
FT                   -> plasmid3 5440bp
FT                   1. plasmid3 remove small ClaI-BglII, 5' PGK control
FT                   2. ClaI-EcoRI-XhoI-SnaBI-BglII linker
FT                   -> pFL60 5400bp
FT                   1. pFL60 remove ClaI-BglII, MCS/5380bp
FT                   NotI linker 8bp gcggccgc
FT                   NotI 5387bp
FT                   2. oligo NotI-BstXI-BstXI-NotI 38bp
FT                   \ ggccgccagtgtgatggctgcatggccagcacactggc
FT                   -> pFL61 5425bp"
FT   misc_binding    0..0
FT                   /note="MCS EcoRI-BanII-SacI-Asp718-KpnI-AvaI-SmaI-
FT                   XmaI-BamHI-XbaI"
FT   misc_binding    0..0
FT                   /note="SIT unique NotI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   rep_origin      0..0
FT                   /note="ORI yeast 2 micron"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   CDS             0..0
FT                   /note="ANT yeast URA3 gene"
XX
SQ   Sequence 1 BP; 0 A; 0 C; 0 G; 0 T; 1 other;
     n
//