back Return to this vector's summary.
ID   PFPCP4     preliminary; circular DNA; SYN; 141 BP.
XX
AC   IG5009;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-APR-1995 (Rel. 11, Last updated, Version 1)
XX
DE   E. coli plasmid vector pFPCP4 - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pFPCP1, pFPCP2 from pBR322mpt5 & fpcp gene
RC   pFPCP3 from pMCR1t1a
RC   pFPCP4 from pFPCP1 & pFPCP3
RC   pFPCP5 from pFPCP2 & pFPCP3
RC   pFPCP6 from pFPCP4 & gene
RC   pFPCP7 from pFPCP6
RA   Gurevich A.I., Nekrasova O.V.;
RT   "[New plasmid vectors for cloning and expression of genes]";
RL   Bioorg. Khim. 14:149-152(1988).
XX
RN   [2]
RC   pBR322mpt5 from pBR322
RA   Korobko V.G., Dobryshin V.N., Chuvpilo S.A., Severtsova I.V.,
RA   Shingarova L.N., Kolosov M.N.;
RT   ;
RL   Bioorg. Khim. 7:309-312(1981).
XX
RN   [3]
RC   pBR322t2 from pBR322 & RNAI gene terminator
RC   pRRN2 from pBR322mpt5 & E. coli rrn term
RC   pMCR1 from pRRN2
RC   pMCR1t1a, pMCR1t1b from ppMCR1 & phage fd terminator
RC   pMCR1t2a, pMCR1t2b from ppMCR1 & RNAI gene terminator
RC   pMCR2 from pRRN2
RA   Gurevich A.I., Babii N.I., Nekrasova O.V., Chernenkaia E.A.,
RA   Kolosov M.N.;
RT   "[New plasmid vectors for the cloning and expression of genes]";
RL   Bioorg. Khim. 11:1356-1360(1985).
XX
CC   not original sequence.
CC   NM (pFPCP4)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pFPCP1 from pBR322mpt5)(M13)
CC   BR (pFPCP5 from pFPCP2 from pBR322mpt5)
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322mpt5
FT                   2. fpcp promoter
FT                   -> pFPCP1
FT                   1. pFPCP1
FT                   2. pFPCP3
FT                   -> pFPCP4"
FT   CDS             0..0
FT                   /note="ANT E. coli tetracycline resistance gene (tet),
FT                   from pBR322mpt5"
FT   rep_origin      complement(0..0)
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322),
FT                   from pBR322mpt5"
FT   CDS             complement(0..0)
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp),
FT                   from pBR322mpt5"
FT   CDS             0..0
FT                   /note="GEN filamentous phage M13 main coat protein"
XX
SQ   Sequence 141 BP; 18 A; 17 C; 16 G; 12 T; 78 other;
     gatcccgcaa aagcggatcc gaattcggta ccattatagc ttnnnnnnnn nnnnnnnnnn
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn
     ctcgggggagatcccgcaaaa
//