back Return to this vector's summary.
ID   PFRTBGAL   preliminary; circular DNA; SYN; 1 BP.
XX
AC   IG2086;
XX
DT   03-FEB-1994 (Rel. 8, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Mammal/E. coli plasmid vector pFRTbetaGAL - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   plasmid from pSKS105 & linker
RC   pFRTbetaGAL from plasmid & pSV2
RC   plasmid2 from pUC19 & FRT gene & pMC1neo-polyA
RC   pNEObetaGAL from pFRTbetaGAL & plasmid2
RC   pOG28 from pCDM8 & mouse DHFR gene
RC   pOG44 from pCDM8 & pMLSIScat & yeast FLP recombinase & yeast 2 micron
RC   pOG45 from pNEObetaGAL & pUC19
RC   pOG45A from pOG45
RA   O'Gorman S., Fox D.T., Wahl G.W.;
RT   "Recombinase-mediated gene activation and site-specific integration
RT   in mammalian cells";
RL   Science 251:1351-1355(1991).
XX
CC   NM (pFRTbetaGAL)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (Stratagene)
CC   HO (E.coli AGI)(mammal cell line E25B2)
CC   CP ()
CC   FN (gene targeting)
CC   SE ()
CC   PA (pSV2)
CC   BR (pFRTbetaGAL)
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pSKS105 remove BamHI-HindIII 20bp, MCS
FT                   \ pUC8 241..261/10000bp
FT                   2. oligo BamHI-HindIII 68bp
FT                   \ gatcccgggctaccatggagaagttcctattccgaagttcctattctcta
FT                   \ gaaagtataggaacttca, FRT site-XbaI-FRT repeat
FT                   -> plasmid 10000bp
FT                   1. plasmid ScaI-EcoRI 5600bp
FT                   \ pMC1403 3640..-..3127/pUC8 231..-..1171
FT                   2. pSV2 remove ScaI-EcoRI, MCS
FT                   \ pSV2-cat EcoRi = 2619 4752
FT                   \ pSV2-cat ScaI = 2106 4339
FT                   -> pFRTbetaGAL [SV40 early prom, lacZ]"
FT   CDS             complement(0..0)
FT                   /note="GEN E. coli beta-galactosidase gene (lac)"
FT   CDS             0..0
FT                   /note="GEN S. cerevisiae FLP recombination targets
FT                   (FRT)"
FT   misc_feature    complement(0..0)
FT                   /note="TER stop codon"
FT   misc_feature    complement(0..0)
FT                   /note="ATG"
FT   promoter        0..0
FT                   /note="PRO SV40 early gene"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             complement(0..0)
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   rep_origin      complement(0..0)
FT                   /note="ORI SV40"
FT   polyA_signal    0..0
FT                   /note="PLA SV40 early gene"
FT   misc_feature    0..0
FT                   /note="SPL SV40 intervening sequence
FT                   with splice acceptor"
XX
SQ   Sequence 1 BP; 0 A; 0 C; 0 G; 0 T; 1 other;
     n
//