back Return to this vector's summary.
ID   PGC1       preliminary; circular DNA; SYN; 82 BP.
XX
AC   M11209;
XX
DT   15-JUN-1988 (Rel. 3, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pGC1 - incomplete, polylinker.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-82
RC   pGC1, pGC2 from pBR322 & linker & GC-rich region & M13, ori
RA   Myers R.M., Lerman L.S., Maniatis T.;
RT   "A general method for saturation mutagenesis of cloned DNA fragments";
RL   Science 229:242-247(1985).
XX
CC   NCBI gi: 207763
CC   NM (pGC1)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA ()
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 NdeI-EcoRI 2063bp 2297..4360, ori/amp
FT                   2. linker EcoRI-NcoI-BglII-BamHI-XbaI-SalI-XhoI-ClaI
FT                   \ 65bp
FT                   \ ggcctggcacgcgctggacgcgcatcgatggcctcgagggtcgactctag
FT                   \ aggatccccagatctggggccatggcgaattc
FT                   3. GC-rich ClaI-HindIII
FT                   4. M13 ?HindIII-?XbaI 671bp 5330..6001, ori
FT                   -> pGC1 2900bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 82 BP; 14 A; 25 C; 29 G; 14 T; 0 other;
     ggcctggcac gcgctggacg cgcatcgatg gcctcgaggg tcgactctag aggatcccca
     gatctggggc catggcgaat tc
//