back Return to this vector's summary.
ID   PGHPSW12   preliminary; circular DNA; SYN; 77 BP.
XX
AC   IG5067;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pGHP-SW12 - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pGHP-SW12 from pBI121
RC   pBI221-XNr from pBI221.1
RC   pGHP-SW22, pGHP-SW4 from pBI221-XNr
RC   pNPL-lambda from pPL-lambda
RC   pGHP-SW51 from pNPL-lambda
RC   pT7T3-18U from pT7T3 & pUC18
RC   pGHP73-SW6 from pT7T3-18U
RA   Georges F., Hussain A., Papish B.;
RT   "Vectors with segmented multiple cloning sites (SMCS) for easy
RT   monitoring of restriction digests and post-cloning orientation
RT   reversal of genes";
RL   Gene 111:27-33(1992).
XX
CC   MCS. oligonucleotide linker.
CC   NM (pGHP-SW12)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pBI121)(pBI221)(pT7T3-18U)(pNPL-lambda)
CC   BR (pGHP-SW22)(pGHP-SW4)(pGHP73-SW7)(pGHP-SW51)
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBI121 remove XbaI-BamHI 6bp, in CaMV & GUS
FT                   \ pBI101 2523..2529/5500bp
FT                   2. oligo XbaI-BamHI 77bp
FT                   \ ctagcatgactagtggccatcgcggccaaactagtatcgatgtcgacgga
FT                   \ tccgcggcccgggcggccgcgatggcc
FT                   -> pGHP-SW12a 5600bp [no XbaI, unique BamHI in MCS]
FT                   1. pGHP-SW12a BamHI 5600bp, in MCS/pBI101 2529..2529
FT                   2. pBR322 XhoII-XhoII 894bp 3117..4011, amp gene
FT                   -> pGHP-SW12 6500bp"
FT   CDS             0..0
FT                   /note="GEN E. coli GUS gene"
FT   terminator      0..0
FT                   /note="TER Agrobacterium Ti NOS gene polyA"
FT   misc_feature    0..0
FT                   /note="Agrobacterium Ti left border"
FT   misc_feature    0..0
FT                   /note="pBIN19"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   misc_feature    0..0
FT                   /note="Agrobacterium Ti right border"
FT   promoter        0..0
FT                   /note="PRO Agrobacterium Ti NOS gene"
FT   CDS             0..0
FT                   /note="GEN E. coli kan gene"
FT   terminator      0..0
FT                   /note="TER Agrobacterium Ti NOS gene polyA"
FT   promoter        0..0
FT                   /note="PRO CaMV 35S gene"
FT   misc_binding    0..0
FT                   /note="MCS SpeI-SfiI-SpeI-ClaI-SalI-XhoII"
FT   CDS             0..0
FT                   /note="GEN E. coli amp gene"
FT   misc_binding    0..0
FT                   /note="MCS XhoII-SstII-SmaI-NotI-SfiI"
XX
SQ   Sequence 77 BP; 14 A; 25 C; 26 G; 12 T; 0 other;
     ctagcatgac tagtggccat cgcggccaaa ctagtatcga tgtcgacgga tccgcggccc
     gggcggccgc gatggcc
//