back Return to this vector's summary.
ID   PGV462     preliminary; circular DNA; SYN; 1617 BP.
XX
AC   IG5108;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pGV462 - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pGV462, pGV463 from pGV451 & oligo
RC   pSKN01 from pIJ702 & pGV462
RC   pSKN02 from pSKN01 & linker
RC   pSKN04 from pSKN02 & linker
RA   Neesen K., Volckaert G.;
RT   "Construction and shuttling of novel bifunctional vectors for
RT   Streptomyces spp. and Escherichia coli";
RL   J. Bacteriol. 171:1569-1573(1989).
XX
CC   MCS. oligonucleotide linker.
CC   NM (pGV462)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pGV451 from pBR325)
CC   BR (pSKN01 from pIJ702 & pGV462)
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR325 remove,
FT                   -> pGV451 1579bp
FT                   1. pGV451 SmaI 1579bp 60..60
FT                   2. oligo Tth111I-SphI-XmaIII-SacI-ApaI-BglI-PvuI-
FT                   SacII-KpnI-SmaI-BamHI-SalI-PstI-Tth111I 38bp
FT                   \ gcatgccagagctctgggcccgatcggccgcggtaccc
FT                   -> pGV462 1617bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 38 BP; 5 A; 15 C; 13 G; 5 T; 0 other;
     gcatgccaga gctctgggcc cgatcggccg cggtaccc
//