back Return to this vector's summary.
ID   PGX2211    preliminary; circular DNA; SYN; 1 BP.
XX
AC   IG5127;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-APR-1995 (Rel. 11, Last updated, Version 1)
XX
DE   E. coli plasmid vector pGX2211 - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pGX2912 from spa gene
RC   pGX2134 from pBR322 & pC194 & apr[BamP] gene
RC   pGX2136 from pGX2134 & pGX2912
RC   pGX2211, pGX2212 from pGX2134 & M13mp19
RC   pGX2214 from pGX2211
RA   Nagarajan V.;
RT   "System for secretion of heterologous proteins in Bacillus subtilis";
RL   Meth. Enzymol. 185:214-223(1990).
XX
CC   oligonucleotide linker + apr gene. not original sequence.
CC   NM (pGX2211)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pBR322)(pC194)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322, ori/amp gene
FT                   2. pC194, ori/cat gene
FT                   3. B. amyloliquefaciens EcoRI-SalI, apr[BamP] gene
FT                   -> pGX2134
FT                   1. M13mp19
FT                   2. cow, pancreatic ribonuclease gene/bpr gene
FT                   -> phage
FT                   1. pGX2134 remove small BamHI-PvuII
FT                   2. phage
FT                   mutagenesis to make BamHI 5' to bpr gene
FT                   BamHI-PvuII, bpr gene
FT                   -> pGX2211"
FT   CDS             0..0
FT                   /note="GEN B. amyloliquefaciens apr[BamP] gene"
FT   misc_binding    0..0
FT                   /note="MCS EcoRI"
FT   misc_binding    0..0
FT                   /note="MCS SmaI"
FT   misc_binding    0..0
FT                   /note="MCS BamHI"
FT   misc_binding    0..0
FT                   /note="MCS ClaI"
FT   misc_binding    0..0
FT                   /note="MCS PvuII"
FT   misc_binding    0..0
FT                   /note="MCS SalI"
FT   junction        0..0
FT                   /note="apr-bpr1 caggcggcaggggatccgaaagag"
FT   CDS             0..0
FT                   /note="ANT E. coli cat gene"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             0..0
FT                   /note="ANT E. coli amp gene"
XX
SQ   Sequence 85 BP; 32 A; 7 C; 22 G; 24 T; 0 other;
     aatctgtcta ttggttattc tgcaaatgaa aaaaaggaga ggataaagag tgagaggcaa
     aaaagtatgg atcagtttgc tgttt
//