back Return to this vector's summary.
ID   PHMG       preliminary; circular DNA; SYN; 1 BP.
XX
AC   IG5159;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-APR-1995 (Rel. 11, Last updated, Version 1)
XX
DE   E. coli plasmid vector pHMG or pCL642 - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pCL640 from pPolyIII-I
RC   plasmid from pCL640 & linker
RC   plasmid2 from plasmid & SV40 polyA
RC   pCL642 or pHMG from plasmid2 & mouse HMGCR promoter/exon/intron
RA   Gautier C., Mehtali M., Lathe R.F.;
RT   "A ubiquitous mammalian expression vector, pHMG, based on a
RT   housekeeping gene promoter";
RL   Nucleic Acids Res. 17:8389-8389(1989).
XX
CC   MCS. oligonucleotide linker.
CC   NM (pHMG)(pCL642)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pPolyIII-i)(pCL640)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pPolyIII-I BglII, ori/amp gene
FT                   fill in
FT                   -> pCL640
FT                   1. pCL640 remove small NotI-NotI
FT                   2. linker NotI-BamHIEcoRV-SalI-KpnI-XhoI-NotI
FT                   ggccgcagatctggatccgatatcgtcgacggtaccctcgaggc
FT                   -> plasmid
FT                   1. plasmid remove KpnI-XhoI, MCS
FT                   2. SV40 KpnI-XhoI, polyA
FT                   -> plasmid2
FT                   1. plasmid2 BamHI, MCS
FT                   2. mouse BamHI-BamHI, HMGCR promoter/exon/intron
FT                   -> pHMG"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 44 BP; 8 A; 14 C; 14 G; 8 T; 0 other;
     ggccgcagat ctggatccga tatcgtcgac ggtaccctcg aggc
//