back Return to this vector's summary.
ID   PHS22      preliminary; circular DNA; SYN; 16000 BP.
XX
AC   M32616; ATCC37840;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Drosophila/E.coli plasmid vector pHS22 - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pHS1 from pMK16 & pKm109/90, Tn5 neo gene
RC   pHS2 from pHS1
RC   pHS7 from pBR322 & linker
RC   pHS8 from pHS7 & pHS2
RC   pHS9 from p82R & pBR322
RC   pHS10 from pHS8 & pHS9
RC   pHS11 from pBR322 & pHS10
RC   pHS13 from pHS11
RC   pHS16 from pHS13 & p906.2
RC   pHS17 from pHS16 & linker
RC   pHS22 from pAP-2 & pHS, hsp82-neo-polyA fragment
RC   pHS24 from pHS17 & pAP-2
RC   pHS82 from pBluescript KS+ & pPLdelta-1
RC   pHS83 from pHS82
RC   pHS84 from pHS83 & linker
RC   pHS85 from pHS84 & pHS, hsp82-neo-polyA fragment
RC   pHS86 from pBluescript KS+ & pHS, hsp82-neo-polyA fragment
RA   Sass H.;
RT   "P-transposable vectors expressing a constitutive and thermoinducible
RT   hsp82-neo fusion gene for Drosophila germline transformation
RT   tissue-culture transfection";
RL   Gene 89:179-186(1990).
XX
RN   [2]
RC   from pHS22 & ppi25.7
RA   Sass H., Meselson M.;
RT   "Dosage compensation of the Drosophila pseudoobscura Hsp82 gene
RT   and the Drosophila melanogaster Adh gene at ectopic sites in D.
RT   melanogaster";
RL   Proc. Natl. Acad. Sci. U.S.A. 88:6795-6799(1991).
XX
RN   [3]
RC   p82R from neo gene
RA   Viglianti G.;
RT   ;
RL   Unpublished (1990).
XX
RN   [4]
RC   lambda 301 from Charon 4A & Drosophila melanogaster hsp-82 gene
RC   lambda 405 from Charon 4A & Drosophila simulans DNA hsp-82 gene
RC   lambda 330 from Charon 30 & Drosophila melanogaster hsp-82 gene
RC   lambda 571 from Charon 30 & Drosophila virilis hsp-82 gene
RC   lambda 906 from Charon 30 & Drosophila pseudoobscura hsp-82 gene
RC   p301.3 from lambda 301
RC   p330.1 from lambda 330
RC   p405.5 from lambda 405
RC   p571.1 from lambda 571
RC   p906.2, p906.4 from lambda 906
RA   Blackman R.K., Meselson M.;
RT   "Interspecific nucleotide sequence comparisons used to identify
RT   regulatory and structural features of the Drosophila hsp82 gene";
RL   J. Mol. Biol. 188:499-515(1986).
XX
RN   [5]
RC   pPLdelta-1 from ppi25.1
RC   pAP-2 from pUC9 & P element & ADH gene & hsp-82 gene
RA   Posakony J.;
RT   ;
RL   Unpublished (1990).
XX
RN   [6]
RC   [pKm109/2 from pKm22 & lac promoter]
RC   pKm109/3 from pKm22 & lac promoter
RC   pKm109/9 from pKm109/3
RC   pKm109/90 from pKm21 & pKm109/3
RC   pKm9 from pKm22
RC   pKm4 from pKm109/3 & linker
RC   pKm936 from pKm4 & pFMDV-1034
RC   pKm133 from pKm936 & pKm22
RC   pKm325 from pBR325 & pKm21 & linker
RC   pPKm1 from pKm21 & pKm22 & pJKK3-1 & linker & B.licheniformis penP
RC   pPKm6 from pKm21 & pKm22 & pJKK3-1 & linker & B.licheniformis penP
RC   pPKm16 from pKm21 & pKm22 & pJKK3-1 & linker & B.licheniformis penP
RC   pPEN109 from pJKK3-1 & pKm109/9 & B.licheniformis penP
RC   pPN1180 from pJKK3-1 & pKm109/9 & B.licheniformis penP
RC   pKm243, pKm243-1, pKm243-2/Tet from pKm2 & linker & pEX150
RC   pKm243a from pKm243
RC   pKm243/T from pKm243 & SV40
RC   pKm243/t from pKm243 & SV40
RC   pKm243/Tet from pKm243 & pBR322/AD16
RA   Reiss B., Sprengel R., Schaller H.;
RT   "Protein fusions with the kanamycin resistance gene from
RT   transposon Tn5";
RL   EMBO J. 3:3317-3322(1984).
XX
RN   [7]
RC   pBR322/AD16 from pBR322 & AD16 gene
RA   Schaller H.;
RT   ;
RL   Unpublished (1984).
XX
RN   [8]
RC   pEX110 from pBR322 & lacUV5 promoter
RC   pEX150 from pBR322
RA   Weiher H.;
RT   ;
RL   Thesis [University of Heidelberg] 0:0-0(1981).
XX
RN   [9]
RC   pPW244 from Drosophila hsp82 gene
RA   Holmgren R., Livak K., Morimoto R., Freund R., Meselson M.;
RT   "Studies of cloned sequences from four Drosophila heat shock loci";
RL   Cell 18:1359-1370(1979).
XX
CC   Contains hsp82-neo fusion gene which encodes the first 20 aa of D.
CC   pseudoobscura hsp82, 5 codons in a linker, fused to the fifth codon of
CC   bacterial neomycin phosphotransferase from Tn5, and followed by
CC   polyadenylation signals from D. melanogaster hsp82. [1]
CC   Genomic clone containing a complete alcohol dehydrogenase coding
CC   region from D. melanogaster (3.2 kb XbaI fragment) which includes
CC   0.66 kb of 5' and 0.64 kb of 3' DNA, and has all the cis-acting
CC   sequences necessary for expression. [1]
CC   The order of the major components of this construct are:3' P-element,
CC   5'-Adh-3', 5'-hsp82-neo fusion-hsp82 polyadenylation signal-3', KpnI
CC   site, and 5' P-element. [1]
CC   The hsp82 sequences begin 5 kb upstream of the transcription starting
CC   point. Expression is constitutive, but can be increased with heat. [1]
CC   Selection of transgenic Drosophila by G418 has been done with embryos,
CC   larvae, and adults. Adults can be reselected by 6% ethanol. [1]
CC   Can be used in Drosophila spp. cell culture transfection assays, and
CC   may function in other animal and plant systems because the hsp82
CC   promoter is highly conserved. [1]
CC   P-transposable (integrating) shuttle vector. [1]
CC   Restriction digests of the clone give the following sizes (kb):
CC   KpnI--16.0; XbaI--9.4, 3.1, 0.90, 0.72, 0.56, 0.30; BamHI/KpnI--7.2,
CC   6.6, 1.3. (ATCC staff)
CC   Medium is 1227 LB plus ampicillin.
CC   NM (pHS22)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli HB101)(Drosophila melanogaster)(E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA ()
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pUC9 2665bp
FT                   2. ppi25.1, P element
FT                   3. yeast XbaI-XbaI 3200bp, ADH gene
FT                   4. hsp-82 gene
FT                   -> pAP-2
FT                   1. pBR322 4361bp
FT                   2. Tn5 XhoI-XhoI 2347bp 486..2833, neo/kan gene
FT                   -> pKm1 6708bp
FT                   1. pBR322 4361bp
FT                   2. E. coli EcoRI-AluI 99bp, lacUV5 promoter-oper
FT                   \ aattctcactcattaggcaccccaggctttacactttatgcttccggctc
FT                   \ gtataatgtgtggaattgtgagcggataacaatttcacacaggaaacag
FT                   -> pEX205
FT                   1. pKm1
FT                   2. pEX205
FT                   -> pKm2
FT                   1. pKm2
FT                   linker
FT                   -> pKm21
FT                   1. pKm2
FT                   linker
FT                   -> pKm22
FT                   1. pKm22
FT                   2. lac promoter
FT                   -> pKm109/3
FT                   1. pKm21
FT                   2. pKm109/3
FT                   -> pKm109/90
FT                   1. ColE1 6646bp
FT                   -> pMK16
FT                   1. pKm109/90 BglII-SalI 1169bp 1516..2685,
FT                   \ promoterless Tn5 neo [1140bp]
FT                   2. pMK16 remove small BamHI-SalI, not ColE1
FT                   -> pHS1
FT                   1. pHS1 SalI, not ColE1
FT                   T4 DNA polymerase, [makes PvuII]
FT                   -> pHS2 [PvuII]
FT                   1. pBR322 EcoRI 4361bp 4360..4360
FT                   Klenow:Klenow
FT                   EcoRI linker 12bp nnngaattcnnn:EcoRI linker 12bp 12bp
FT                   \ nnngaattcnnn
FT                   NruI-NruI
FT                   -> pHS7 4400bp
FT                   1. pHS7 remove small BamHI-XmaIII 564bp 376..940,
FT                   \ 3800bp
FT                   2. pHS2 BamHI-XmaIII 1428bp 1629..3057, neo/kan gene
FT                   -> pHS8 5200bp
FT                   1. hsp82 gene
FT                   -> p82R
FT                   1. p82R EcoRI-EcoRI 4300bp, hsp82 gene
FT                   PvuI-EcoRI 340bp 3788..4128, hsp82 gene polyA
FT                   2. pBR322 remove PvuI-EcoRI 623bp 3737..4360, 3738bp
FT                   -> pHS9 4100bp
FT                   1. pHS8 remove small PvuI-EcoRI, 4900bp
FT                   2. pHS9 PvuI-EcoRI 340bp 3788..4128, hsp82 gene polyA
FT                   -> pHS10 5200bp
FT                   1. pBR322 remove EcoRI-BamHI 377bp 4360..4361..376,
FT                   \ tet/3984bp
FT                   2. pHS10 EcoRI-BamHI 1471bp
FT                   -> pHS11 5400bp [unique SalI]
FT                   1. pHS11 EcoRI 5400bp 0..0
FT                   T4 DNA polymerase
FT                   KpnI linker 8bp nggtaccn
FT                   -> pHS13 5400bp
FT                   1. D. pseudoobscura MboI-MboI 15000bp, hsp82 gene
FT                   2. Charon 30 BamHI
FT                   -> lambda 906
FT                   1. lambda 906, hsp82 promoter
FT                   2. pBR322 4361bp
FT                   -> p906.2
FT                   1. pHS13 remove small BamHI-SalI 276bp,
FT                   \ pBR322 376..652, 5100bp
FT                   2. p906.2 BclI-SalI, D. pseudoobscura hsp82 promoter
FT                   -> pHS16 5400bp
FT                   1. pHS16 SalI 5400bp, pBR322 652..652
FT                   fill in
FT                   BamHI linker 12bp nnnggatccnnn
FT                   -> pHS17 5400bp [SalI, unique BamHI]
FT                   1. pHS17 ClaI-BamHI 800bp, no hsp82 5' to -865
FT                   T4 DNA polymerase:T4 DNA polymerase
FT                   -> pHS[neo-4.2.2.KpnI(3')/BamHI(-865)] [unique BamHI]
FT                   1. pAP-2 large BglII-KpnI 12000bp, P element/Adh gene
FT                   2. pHS[neo-4.2.2.KpnI(3')/BamHI(-865)]
FT                   BamHI-KpnI 3730bp, hsp82-neo-polyA fragment
FT                   -> pHS22 16000bp"
FT   misc_binding    0..0
FT                   /note="SIT unique KpnI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   promoter        0..0
FT                   /note="PRO Drosophila hsp82 gene"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   CDS             0..0
FT                   /note="ANT Drosophila G418 resistance gene (G418)"
FT   CDS             0..0
FT                   /note="GEN Drosophila Adh+ gene"
XX
SQ   Sequence 1 BP; 0 A; 0 C; 0 G; 0 T; 1 other;
     n
//