back Return to this vector's summary.
ID   PHSE3      preliminary; circular DNA; SYN; 173 BP.
AC   M29589;
DT   15-MAR-1990 (Rel. 5, Created)
DT   01-APR-1995 (Rel. 11, Last updated, Version 1)
DE   Vaccinia virus WR plasmid vector pHSE3 - incomplete, H6 promoter.
KW   cloning vector; H6 promoter.
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
RN   [1]
RP   1-173
RC   pMP5 from pUC13 & pAG5
RC   pMP528 from pMP5 & pAG5
RC   pMP528L from pMP528 & linker
RC   pMP528PiN from pMP528L & vaccinia virus
RC   vP293 from pMP528PiN & helper virus VTK' 79
RC   pMP528E from pMP528L
RC   pUC8HR from pUC8 & KIL gene
RC   pMP528HR from pMP528E & pUC8HR
RC   vP457 from pMP528HR & vP293
RC   pMP528HRH from pMP528HR
RC   pHES1 from pMP528HRH & oligo
RC   pHES2 from pMP528HRH & oligo
RC   pHES3 from pMP528HRH & oligo
RC   pHES4 from pMP528HRH & oligo
RA   Perkus M.E., Limbach K., Paoletti E.;
RT   "Cloning and expression of foreign genes in vaccinia virus, using a
RT   host range selection system";
RL   J. Virol. 63:3829-3836(1989).
RN   [2]
RP   1-171
RC   pHSE3
RA   Paoletti E.;
RT   ;
RL   Submitted (31-OCT-1989) by:
RL   Paoletti E., .
CC   NCBI gi: 209549
CC   NM (pHSE3)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (vaccinia virus WR)
CC   BR ()
CC   OF ()
CC   OR ()
FH   Key             Location/Qualifiers
FT   misc_feature    0..0
FT                   /note="1. pUC13 remove EcoRI-SalI, MCS
FT                   2. pAG5 EcoRI-SalI 3800bp, left vaccinia virus 1..3800
FT                   -> pMP5
FT                   1. pMP5 remove HindIII-SalI, MCS
FT                   2. pAG5 HindIII-SalI, right vaccinia 25500..29300
FT                   -> pMP528
FT                   1. pMP528 SalI
FT                   SmaI linker
FT                   -> pMP528L
FT                   1. pMP528L remove EcoRV-HindIII 3400bp, right vaccinia
FT                   Klenow fill in:Klenow fill in
FT                   -> pMP528E
FT                   1. pUC8 remove BglII-HpaI, MCS
FT                   2. KIL gene BglII-HpaI
FT                   -> pUC8HR
FT                   1. pMP528E SmaI
FT                   2. pUC8HR HindIII-SmaI, KIL gene
FT                   Klenow fill in:
FT                   -> pMP528HR
FT                   1. pMP528HR SmaI
FT                   2. oligo SmaI-H6 promoter-XhoI-KpnI-SmaI
FT                   [see sequence]
FT                   -> pMP528HRH
FT                   1. pMP528HRH XhoI-XmaI
FT                   2. oligo XhoI-XmaI 55bp
FT                   tcgaccatgggggatccccgggtaccgagctctcgagtaaataaataa
FT                   tttttat
FT                   -> pHES3"
FT   rep_origin      0..0
FT                   /note="ORI"
SQ   Sequence 173 BP; 59 A; 22 C; 32 G; 60 T; 0 other;
     ttctttattc tatacttaaa aagtgaaaat aaatacaaag gttcttgagg gttgtgttaa
     attgaaagcg agaaataatc ataaattatt tcattatcgc gatatccgtt aagtttgtat
     cgtaatgggg gatccccggg taccgagctc tcgagtaaat aaataatttt tat