back Return to this vector's summary.
ID   PHSS6      preliminary; circular DNA; SYN; 2320 BP.
XX
AC   M84115;
XX
DT   01-JUN-1994 (Rel. 10, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli vector pHSS6 - incomplete, kan gene.
XX
KW   cloning vector; kanamycin gene.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pHSS6 from kan gene
RA   Seifert H.S., So M., Heffron F.;
RT   "Shuttle mutagenesis: a method of introducing transposons into
RT   transformable organisms";
RL   Genet. Eng. 8:327-336(1986).
XX
RN   [2]
RP   1-2320
RC   pUC19Km from pUC19 & pRZ102
RC   pHSS3 from pFH97 & pUC19Km
RC   pHSS4 from pHSS3 & linker
RC   pHSS6 from pHSS4 & plink322
RC   pHSS9 from pHSS6 & M13
RC   pHSS10 from pHSS9
RC   pTn from pRH43 & pIR38-8
RC   from pTn
RA   Seifert H.S., Chen E.Y., So M., Heffron F.;
RT   "Shuttle mutagenesis: a method of transposon mutagenesis for
RT   Saccharomyces cerevisiae";
RL   Proc. Natl. Acad. Sci. U.S.A. 83:735-739(1986).
XX
CC   Cloning vector pHSS6 is used in the system of shuttle mutagenesis.
CC   NCBI gi: 146531
CC   NM (pHSS6)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA ()
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 4361bp, ori/amp
FT                   2. E. coli 1600bp, kan gene
FT                   -> pRZ102 6000bp
FT                   1. pUC19 remove SalI-HindIII 18bp 430..448, MCS/2668bp
FT                   2. pRZ102 HindIII-SalI 30..-..652, kan gene/1600bp
FT                   -> pUC19Km 4300bp
FT                   1. pMB8
FT                   -> pFH97
FT                   1. pFH97 NdeI-EcoRI 700bp, ori
FT                   Klenow:
FT                   2. pUC19Km remove small XmaI-XmaI
FT                   HindIII-EcoRI 30..-..4360, kan gene/1600bp
FT                   Klenow:
FT                   -> pHSS3 2300bp [HindIII]
FT                   1. pHSS3 remove small EcoRI-XmaI, 2200bp
FT                   2. oligo EcoRI-XmaI 33bp
FT                   \ ccgggcggccgcggatccgaattccgcggccgc
FT                   -> pHSS4 2200bp
FT                   1. pHSS4 HindIII 2200bp
FT                   Klenow
FT                   remove small EcoRI-BamHI
FT                   2. plink322 EcoRI-BamHI 92bp, MCS
FT                   -> pHSS6 2320bp"
FT   misc_binding    0..0
FT                   /note="MCS EcoRI-ClaI-HindIII-XbaI-BglII-PstI-BamHI"
FT   misc_feature    complement(1232..2026)
FT                   /note="ANT E. coli kanamycin resistance gene (neo)
FT                   from Tn5"
FT   rep_origin      1442..1442
FT                   /note="ORI M13 origin, from pHSS7;
FT                   a 191 bp fragment from pSJ1 (Johnston
FT                   & Ray, JMB 177:685-700, 1984) was inserted at this
FT                   position to make the derivative pHSS7"
FT   rep_origin      1660..1660
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322),
FT                   direction=left"
XX
SQ   Sequence 2320 BP; 509 A; 698 C; 619 G; 494 T; 0 other;
     gcggccgcgg aattctcatg tttgacagct tatcatcgat aagcttctag agatcttcca
     tacctaccag ttctccgcct gcagcaatgg caacaacgtt gcccggatcc gcggccgccc
     ggggtgggcg aagaactcca gcatgagatc cccgcgctgg aggatcatcc agccggcgtc
     ccggaaaacg attccgaagc ccaacctttc atagaaggcg gcggtggaat cgaaatctcg
     tgatggcagg ttgggcgtcg cttggtcggt catttcgaac cccagagtcc cgctcagaag
     aactcgtcaa gaaggcgata gaaggcgatg cgctgcgaat cgggagcggc gataccgtaa
     agcacgagga agcggtcagc ccattcgccg ccaagctctt cagcaatatc acgggtagcc
     aacgctatgt cctgatagcg gtccgccaca cccagccggc cacagtcgat gaatccagaa
     aagcggccat tttccaccat gatattcggc aagcaggcat cgccatgggt cacgacgaga
     tcctcgccgt cgggcatgcg cgccttgagc ctggcgaaca gttcggctgg cgcgagcccc
     tgatgctctt cgtccagatc atcctgatcg acaagaccgg cttccatccg agtacgtgct
     cgctcgatgc gatgtttcgc ttggtggtcg aatgggcagg tagccggatc aagcgtatgc
     agccgccgca ttgcatcagc catgatggat actttctcgg caggagcaag gtgagatgac
     aggagatcct gccccggcac ttcgcccaat agcagccagt cccttcccgc ttcagtgaca
     acgtcgagca cagctgcgca aggaacgccc gtcgtggcca gccacgatag ccgcgctgcc
     tcgtcctgca gttcattcag ggcaccggac aggtcggtct tgacaaaaag aaccgggcgc
     ccctgcgctg acagccggaa cacggcggca tcagagcagc cgattgtctg ttgtgcccag
     tcatagccga atagcctctc cacccaagcg gccggagaac ctgcgtgcaa tccatcttgt
     tcaatcatgc gaaacgatcc tcatcctgtc tcttgatcag atcttgatcc cctgcgccat
     cagatccttg gcggcaagaa agccatccag tttactttgc agggcttccc aaccttacca
     gagggcgccc cagctggcaa ttccggttcg cttgctgtcc ataaaaccgc ccagtctagc
     tatcgccatg taagcccact gcaagctacc tgctttctct ttgcgcttgc gttttccctt
     gtccagatag cccagtagct gacattcatc cggggtcagc accgtttctg cggactggct
     ttctacgtgt tccgcttcct ttagcagccc ttgcgccctg agtgcttgcg gcagcgtgaa
     gctagcttat gcggtgtgaa ataccgcaca gatgcgtaag gagaaaatac cgcatcaggc
     gctcttccgc ttcctcgctc actgactcgc tgcgctcggt cgttcggctg cggcgagcgg
     tatcagctca ctcaaaggcg gtaatacggt tatccacaga atcaggggat aacgcaggaa
     agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg
     cgtttttcca taggctccgc ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga
     ggtggcgaaa cccgacagga ctataaagat accaggcgtt tccccctgga agctccctcg
     tgcgctctcc tgttccgacc ctgccgctta ccggatacct gtccgccttt ctcccttcgg
     gaagcgtggc gctttctcat agctcacgct gtaggtatct cagttcggtg taggtcgttc
     gctccaagct gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc gccttatccg
     gtaactatcg tcttgagtcc aacccggtaa gacacgactt atcgccactg gcagcagcca
     ctggtaacag gattagcaga gcgaggtatg taggcggtgc tacagagttc ttgaagtggt
     ggcctaacta cggctacact agaaggacag tatttggtat ctgcgctctg ctgaagccag
     ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa acaaaccacc gctggtagcg
     gcggtttttt gtttgcaagc agcagattac gcgcagaaaa aaaggatctc aagaagatcc
     tttgatcttt tcttactgaa cggtgatccc caccggaatt
//