back Return to this vector's summary.
ID   PICL       preliminary; circular DNA; SYN; 8400 BP.
XX
AC   ATCC77408;
XX
DT   03-FEB-1994 (Rel. 8, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Saccharomyces/E.coli plasmid vector pICL - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pHSS6deltaH from pHSS6
RC   pHSSLys from pHSS6deltaH & p1-L13, LYS2 gene
RC   p18Lys from pHSSLys & pTZ18R
RC   pICL from p18Lys & linker
RC   pHSSLysL from pHSSLys & T7 linker
RC   plasmid from pBluescript II & linker & pYAC4, URA
RC   pLUS from plasmid & pHSSLysL
RC   [pOJ31 from pBR322 & kan gene & lambda, cos]
RA   Hermanson G.G., Hoekstra M.F., McElligott D.L., Evans G.A.;
RT   "Rescue of end fragments of yeast artificial chromosomes by
RT   homologous recombination in yeast";
RL   Nucleic Acids Res. 19:4943-4948(1991).
XX
RN   [2]
RC   p1-L13 from LYS2 gene
RA   Falco S.C.;
RT   ;
RL   Unpublished (1991).
XX
CC   Deposited by: Gary G. Hermanson
CC   Restriction digests of the clone give the following sizes (kb):
CC   KpnI--6.3, 1.5, 0.6; SstI--8.4; BamHI--4.6, 3.8. (ATCC staff)
CC   TRP from pYAC4 is not really functional. (personal communication)
CC   Linearized vector is transformed into the YAC-containing yeast cells,
CC   followed by plating on medium lacking lysine and uracil (and
CC   containing 10 mg/L adenine to enhance the red color phenotype of
CC   recombinant clones). [1]
CC   YAC end fragment clones can be isolated from properly integrated DNA
CC   by digestion with one of the enzymes in the polylinker, religation by
CC   circularization, and transformation into Escherichia coli. [1]
CC   Vector designed to rescue the CEN end of an insert from a yeast
CC   artificial chromosome (YAC) constructed in a pYAC4-derived vector.
CC   Based on homologous recombination with the pYAC vector. [1]
CC   Positive colonies should have the rescue plasmid integrated into the
CC   YAC clone near the ScaI site in the beta-lactamase (ampR) gene. [1]
CC   DNA from positive colonies can be screened for proper integration of
CC   the vector using the following primers:
CC   5'- GCGCTTAATGCGCCGCTACAGGGCG -3' and
CC   5'- GCTCACCGGCTCCAGATTTATCAGC -3', complementary to the f1 ori and
CC   ampR sequences respectively. [1]
CC   Correctly integrated products will yield a 870 bp amplification
CC   product, that should be cleaved by PstI into two fragments: 705 bp and
CC   165 bp. [1]
CC   The order of the major features of the rescue vector is:  T7 promoter
CC   - SacI/polylinker/BamHI - LYS2 - XbaI - SphI - ScaI/ampR - pMB1 ori.
CC   [1]
CC   The order of the major features in a rcombinant YAC end fragment clone
CC   would be: T7 promoter - BamHI/polylinker/SacI - CEN end YAC insert -
CC   EcoRI - CEN - ARS - (TRP) - ScaI/ampR - pMB1 ori. [1]
CC   Medium is 1227 LB plus ampicillin.
CC   NM (pICL)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli)(E.coli HB101)(E.coli XL-1-Blue)(Saccharomyces cerevisiae)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA ()
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pHSS6 HindIII 2320bp, pBR322 30..30
FT                   Klenow
FT                   -> pHSS6deltaH 2320bp
FT                   1. yeast, LYS2 gene
FT                   -> p1-L13
FT                   1. pHSS6deltaH remove EcoRI-ClaI, MCS/2300bp
FT                   2. p1-L13 EcoRI-ClaI 5000bp, LYS2 gene
FT                   -> pHSSLys 7300bp
FT                   1. pHSSLys EcoRI-XbaI 5000bp, LYS2 gene
FT                   2. pTZ18R remove XbaI-EcoRI 27bp 187..214, MCS/2834bp
FT                   -> p18Lys 8400bp
FT                   1. p18Lys EcoRI 8400bp 214..214
FT                   2. linker EcoRI-KpnI-SphI-SacI-BamHI-EcoRI 28bp
FT                   \ aattggtaccgcatgcgagctcggatcc
FT                   -> pICL 8400bp"
FT   misc_binding    0..0
FT                   /note="MCS BamHI-KpnI-SphI-SacI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   rep_origin      0..0
FT                   /note="ORI yeast ARS1"
FT   promoter        0..0
FT                   /note="PRO bacteriophage T7"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   CDS             0..0
FT                   /note="ANT yeast LYS2 gene"
XX
SQ   Sequence 28 BP; 6 A; 8 C; 8 G; 6 T; 0 other;
     aattggtacc gcatgcgagc tcggatcc
//