back Return to this vector's summary.
ID   PJB63      preliminary; circular DNA; SYN; 62 BP.
XX
AC   M18150;
XX
DT   15-MAR-1989 (Rel. 4, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pJB63 - incomplete, promoter.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-62
RC   pLK12 from pBR322 & pBRT7, fd terminator
RC   pLK31, pLK32 from pAD33 & pLK12
RC   pLK33 from pAD19 & pLK12
RC   pLK34, pLK36, pLK34-1, pLK36-1 from pUC8 & pLK12
RC   pLK37, pLK38 from M13tg131 & pLK12
RC   pLK39 from pLK12
RC   pLK82 from pLK12 & pUK217
RC   pLK84 from pMC1871 & pLK12
RC   pLK59, pLK50 series from pPLc28 & pLK12
RC   pLK60, pLK69, pLK60 series from pCQV2 & pLK12
RC   pLK70 series from pCL series & pLK12
RC   pLK90 series from pK30 series & pKTH601
RC   pRL86 from pPLcAT14
RC   pJB63, pJB64, pJB65, pJB66 from pLK60 & linker
RC   pR60 from pLK60 series
RA   Botterman J., Zabeau M.;
RT   "A standardized vector system for manipulation
RT   and enhanced expression of genes in Escherichia coli";
RL   DNA 6:583-591(1987).
XX
RN   [2]
RC   pAD19 from amp gene
RC   pAD33 from amp gene
RA   Schaller H.;
RT   ;
RL   Unpublished (1987).
XX
RN   [3]
RC   pBRT7 from phage fd terminator & amp gene
RA   Reiss B.;
RT   ;
RL   Unpublished (1987).
XX
RN   [4]
RC   pEcoR4 from pACYC184 & metRI gene
RC   pEcoR251 from pACYC184 & endRI gene & lambda, pR
RC   pEcoR150 from pACYC184 & endRI gene
RC   pEcoR67 from pACYC184 & metRI gene & endRI gene
RC   pEcoR270 from pACYC184 & endRI gene & term
RC   pEL1 from pCL19 & pEcoR251
RC   pEL2 from pCL19 & pEcoR150
RC   pCL19delta YT from pCL19
RC   pLK52 from pPLc28
RC   pLK80 from pCL19delta YT & pLK52
RC   pEL2, pEL4, pEL5, pEL9, pEL12, pEL16 from pLK80 & pEcoR67
RC   pEcoR305 from pEcoR270 & pEL5
RC   pEcoR300 series from pEcoR270 & pEL series
RA   Botterman J., Zabeau M.;
RT   "High-level production of the EcoRI endonuclease under the
RT   control of the PL promoter of bacteriophage lambda";
RL   Gene 37:229-239(1985).
XX
CC   NCBI gi: 208264
CC   NM (pJB63)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pLK63)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322
FT                   2. phage fd 100bp, terminator
FT                   -> pBRT7 4400bp
FT                   1. pBR322 remove EcoRI-PvuII 2068bp
FT                   \ 4360..4361..2067, 2293bp
FT                   2. pBRT7 EcoRI*-EcoRI* 99bp, fd terminator
FT                   -> pLK12 2392bp
FT                   1. pCQV2, 3000bp-
FT                   2. pLK12 2392bp
FT                   -> pLK60 3000bp
FT                   1. pLK60 3000bp
FT                   2. linker 62bp gatccgcgggccctcgagct
FT                   \ caagcttggtaccagatctgatctcacgcgtctagaggtcga
FT                   -> pJB63 3000bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 62 BP; 12 A; 19 C; 18 G; 13 T; 0 other;
     gatccgcggg ccctcgagct caagcttggt accagatctg atctcacgcg tctagaggtc
     ga
//