back Return to this vector's summary.
ID   PJB65      preliminary; circular DNA; SYN; 59 BP.
XX
AC   M18151;
XX
DT   15-MAR-1989 (Rel. 4, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pJB65 - incomplete, promoter.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-59
RC   pLK12 from pBR322 & pBRT7, fd terminator
RC   pLK31, pLK32 from pAD33 & pLK12
RC   pLK33 from pAD19 & pLK12
RC   pLK34, pLK36, pLK34-1, pLK36-1 from pUC8 & pLK12
RC   pLK37, pLK38 from M13tg131 & pLK12
RC   pLK39 from pLK12
RC   pLK82 from pLK12 & pUK217
RC   pLK84 from pMC1871 & pLK12
RC   pLK59, pLK50 series from pPLc28 & pLK12
RC   pLK69, pLK60 series from pCQV2 & pLK12
RC   pLK70 series from pCL series & pLK12
RC   pLK90 series from pK30 series & pKTH601
RC   pRL86 from pPLcAT14
RC   pJB63, pJB64, pJB65, pJB66 from pLK60 & linker
RC   pR60 from pLK60 series
RA   Botterman J., Zabeau M.;
RT   "A standardized vector system for manipulation
RT   and enhanced expression of genes in Escherichia coli";
RL   DNA 6:583-591(1987).
XX
CC   NCBI gi: 208265
CC   NM (pJB65)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pLK65)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 4361bp
FT                   2. phage fd 100bp, terminator
FT                   -> pBRT7 4400bp
FT                   1. pBR322 remove EcoRI-PvuII 2068bp
FT                   \ 4360..4361..2067, 2293bp
FT                   2. pBRT7 EcoRI*-EcoRI* 99bp, fd terminator
FT                   -> pLK12 2392bp
FT                   1. pCQV2
FT                   2. pLK12
FT                   -> pLK60
FT                   1. pLK60
FT                   2. linker 59bp gtaccagatctgatctcacgcgtctagagg
FT                   \ taccgcatgcgatatcgagctctcccggg
FT                   -> pJB65"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 59 BP; 12 A; 18 C; 16 G; 13 T; 0 other;
     gtaccagatc tgatctcacg cgtctagagg taccgcatgc gatatcgagc tctcccggg
//