back Return to this vector's summary.
ID   PJS97      preliminary; circular DNA; SYN; 7200 BP.
XX
AC   IG1158; ATCC77153;
XX
DT   02-NOV-1992 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Saccharomyces/E.coli YAC/plasmid vector pJS97 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pJS70 from YCF3 & pAB9, histone H4 ARS
RC   pJS72 from pJS70 & TRP1 gene
RC   pJS73 from pJS72
RC   pJS77 from pUC19 & pJS73
RC   pJS78 from pUC19 & pJS70
RC   pJS89 from pJS77 & oligo
RC   pJS90 from pJS78 & oligo
RC   pJS91 from YCF4 & pJS90
RC   plasmid from pYAC4 & pSP73
RC   pJS98 from pJS89 & plasmid, Tetrahymena telomere
RC   pJS97 from pJS91 & plasmid, Tetrahymena telomere
RA   Shero J.H., McCormick M., Antonarakis S., Hieter P.;
RT   "Yeast artificial chromosome vectors for efficient clone
RT   manipulation and mapping";
RL   Genomics 10:505-508(1991).
XX
RN   [2]
RC   pJS97 from pJS91 & plasmid, Tetrahymena telomere
RC   pJS98 from pJS89 & plasmid, Tetrahymena telomere
RA   Kotewicz M.L.;
RT   ;
RL   Focus 13:30-30(1991).
XX
RN   [3]
RC   YRp14CEN4 from YRp14 & YCp19
RC   pAB4 from YIp5 & pMS191, histone H4 ARS
RC   pAB9 from pUC8 & pAB4
RC   from pAB9
RA   Bouton A.H., Smith M.M.;
RT   "Fine-structure analysis of the DNA sequence requirements for
RT   autnomous replication of Saccharomyces cerevisiae plasmids";
RL   Mol. Cell. Biol. 6:2354-2363(1986).
XX
CC   ATCC size is 7300 bp.
CC   pJS97 has URA3 marker and pJS98 has TRP1 marker; double selection
CC   ensures only clones with a whole YAC.
CC   YL-type shuttle vector useful for construction of genomic libraries.
CC   Contains promoters for in vitro RNA synthesis and permits recovery of
CC   end fragments as plasmids in E. coli. [4]
CC   pJS97 (ATCC 77153) and pJS98 (ATCC 77154) are used together to
CC   construct artificial chromosomes. Each plasmid is digested with ClaI
CC   and the cloning enzyme. [4]
CC   The order of the major features in this plasmid is: ClaI/MCS/EcoRI -
CC   T7 promoter - ARSH4 - CEN4 - URA3 - SUP11 - pMB1 ori - bla - SacI -
CC   BamHI - SphI - TEL. [4]
CC   To recover both ends of a YAC insert as plasmid, DNA of a
CC   YAC-containing strain is digested to completion with BamHI, SphI or
CC   SacI, diluted, ligated, and transformed into E. coli (to ampicillin
CC   resistance). [4]
CC   The insert of a resultant plasmid (which includes the T7 promoter)
CC   extends from an end of the YAC insert to the first site of the enzyme
CC   used for digestion. [4]
CC   Restriction digests of the clone give the following sizes (kb):
CC   NotI--7.4; BglII--7.4; SalI--7.4; EcoRI--7.4; SacI--7.4. (ATCC staff)
CC   Medium is 1227 LB plus ampicillin.
CC   NM (pJS97)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (yeast artificial chromosome)(plasmid)
CC   SP (BRL)(ATCC)
CC   HO (S.cerevisiae YPH274)(E.coli HB101)(E.coli)(S.cerevisiae)
CC   HO (S.cerevisiae YPH252)(S.cerevisiae YPH857)
CC   CP ()
CC   FN (amplification)(screening)(cloning up to 1000000 bp)
CC   SE (color red/white)
CC   PA (pUC19)
CC   BR (pJS98)
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. histone H4 ARS
FT                   -> pMS191
FT                   1. YIp5 BamHI 5541bp 379..379
FT                   2. pMS191 Sau3A/MboI-Sau3A/MboI 374bp, histone H4 ARS
FT                   -> pAB4 5915bp
FT                   1. pUC8 BamHI 2665bp 241..241
FT                   2. pAB4 Sau3A/MboI-Sau3A/MboI 374bp, histone H4 ARS
FT                   -> pAB9 3039bp
FT                   1. YCF3 SmaI-HindIII 3031bp, amp/Y'a
FT                   \ YIp5 2543..5541..33
FT                   2. pAB9 HindIII-SmaI 374bp, histone H4 ARS
FT                   -> pJS70 3405bp
FT                   1. pJS70 SmaI 3405bp 2543..2543
FT                   2. yeast BglII-BglII 1800bp, TRP1 gene
FT                   Klenow:Klenow
FT                   -> pJS72 5200bp
FT                   1. pJS72 EcoRI 5200bp, TRP1 gene/YIp5 2..2
FT                   Klenow
FT                   -> pJS73 5200bp
FT                   1. pUC19 EcoRI 2686bp 397..397, MCS
FT                   fill in
FT                   SalI 2686bp 430..430, MCS
FT                   fill in
FT                   HindIII-SphI 2684bp 448..2686..446, MCS
FT                   blunt end:
FT                   2. pJS70 SmaI-SphI 3500bp,
FT                   \ Y'a/MCS/ARSH4/YIp5 2543..5541..570
FT                   -> pJS78 6200bp
FT                   1. pJS78 remove small BglII-SalI, YIp5 SalI 655
FT                   2. oligo 76bp
FT                   \ gatcatcgatttcgaagctagctcgcgagtcgaccgcggccgcagatctg
FT                   \ aattcgccctatagtgagtcgtatta
FT                   -> pJS90 6200bp
FT                   1. YCF4 remove small HpaI-NruI
FT                   PvuII-Asp718, CEN4/URA3/SUp11
FT                   Klenow:Klenow
FT                   2. pJS90 remove small PvuII-PvuII
FT                   -> pJS91
FT                   1. pYAC4 XhoI-BamHI 705bp 3533..4238,
FT                   \ Tetrahymena telomere
FT                   2. pSP73 remove BamHI-SalI 12bp 46..58, MCS/2452bp
FT                   -> plasmid 3157bp
FT                   1. pJS91 remove small SphI-ClaI, Y'a element
FT                   2. plasmid EcoRI-BamHI 726bp 25..46..-,
FT                   \ Tetrahymena telomere
FT                   Klenow:Klenow
FT                   ClaI-SphI 747bp 20..46..-..58..74,Tetrahymena telomere
FT                   -> pJS97 7300bp"
FT   misc_binding    0..0
FT                   /note="MCS unique SstI-BamHI-SphI"
FT   misc_feature    0..0
FT                   /note="Tetrahymena telomere"
FT   misc_binding    0..0
FT                   /note="MCS unique ClaI-NheI-NruI-SalI-NotI-XmaIII-
FT                   BglII-EcoRI"
FT   promoter        complement(0..0)
FT                   /note="PRO bacteriophage T7"
FT   rep_origin      0..0
FT                   /note="ORI yeast ARS H4"
FT   misc_feature    0..0
FT                   /note="yeast centromere CEN4 (for chromosome
FT                   segregation and stability)"
FT   CDS             0..0
FT                   /note="ANT yeast URA3 gene (uracil)"
FT   CDS             0..0
FT                   /note="ANT yeast SUP11 gene"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             complement(0..0)
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
XX
SQ   Sequence 76 BP; 17 A; 20 C; 20 G; 19 T; 0 other;
     gatcatcgat ttcgaagcta gctcgcgagt cgaccgcggc cgcagatctg aattcgccct
     atagtgagtc gtatta
//