back Return to this vector's summary.
ID   PLUS       preliminary; circular DNA; SYN; 9500 BP.
XX
AC   ATCC77407;
XX
DT   01-DEC-1994 (Rel. 10, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Saccharomyces/E.coli plasmid vector pLUS - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pHSS6deltaH from pHSS6
RC   pHSSLys from pHSS6deltaH & p1-L13, LYS2 gene
RC   p18Lys from pHSSLys & pTZ18R
RC   pICL from p18Lys & linker
RC   pHSSLysL from pHSSLys & T7 linker
RC   plasmid from pBluescript II & linker & pYAC4, URA
RC   pLUS from plasmid & pHSSLysL
RC   [pOJ31 from pBR322 & kan gene & lambda, cos]
RA   Hermanson G.G., Hoekstra M.F., McElligott D.L., Evans G.A.;
RT   "Rescue of end fragments of yeast artificial chromosomes by
RT   homologous recombination in yeast";
RL   Nucleic Acids Res. 19:4943-4948(1991).
XX
CC   Vector designed to rescue the URA3 end of an insert from a yeast
CC   artificial chromosome (YAC) constructed in a pYAC4-derived vector.
CC   Based on homologous recombination with the pYAC vector.
CC   Linearized vector is transformed into the YAC-containing yeast
CC   cells, followed by plating on medium lacking lysine and uracil
CC   (and containing 10 mg/L adenine to enhance the red color phenotype
CC   of recombinant clones).
CC   Positive colonies should have the rescue plasmid integrated into the
CC   artificial chromosome near the SalI site from pYAC4 (near URA3).
CC   DNA from positive colonies can be screened for proper integration of
CC   the vector using the following primers:
CC   5'- CTTGAGATCGGGCGTTCGACTCGC -3' and 5'-TGAACGGTGATCCCCACCGGAATTG -3',
CC   complementary to the YAC clone and the vector respectively.
CC   Correctly integrated products will yield a 1855 bp
CC   amplification product.
CC   YAC end fragment clones can be isolated from
CC   properly integrated DNA by digestion with one of the enzymes in the
CC   polylinker, religation by circularization, and transformation into
CC   Escherichia coli.
CC   Permits isolation of end fragments up to 20 kb.
CC   The order of the major features of the rescue vector is: T7 promoter -
CC   BamHI/polylinker/HindIII - LYS2 - EcoRI - SUP4 - SalI/YAC4 - URA3 -
CC   EcoRI - pMB1 ori - kanR.
CC   The order of the major features in a recombinant YAC end fragment
CC   clone would be:  T7 promoter - BamHI/polylinker/HindIII -
CC   URA end YAC insert - EcoRI - SalI/YAC4 - pMB1 ori - kanR. [1]
CC   Growth medium: LB plus kanamycin. 37C
CC   Deposited by: G.G.Hermanson
CC   NM (pLUS)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli)(Saccharomyces)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA ()
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pHSS6 HindIII 2320bp, pUC19 448..448
FT                   Klenow
FT                   -> pHSS6deltaH 2320bp
FT                   1. yeast, LYS2 gene
FT                   -> p1-L13
FT                   1. pHSS6deltaH remove EcoRI-ClaI, MCS/2300bp
FT                   2. p1-L13 EcoRI-ClaI 5000bp, LYS2 gene
FT                   -> pHSSLys 7300bp
FT                   1. pHSSLys remove SmaI-HindIII, MCS/7000bp
FT                   2. oligo blunt-T7-HindIII-XbaI-SacI-KpnI-BamHI-HindIII
FT                   \ 44bp agcttctagagctcggtaccggatccctatagtgagtcgtatta
FT                   -> pHSSLysL 7000bp
FT                   1. pBluescript II KS+ BamHI 2961bp 690..690
FT                   EcoRI linker 6bp gaattc
FT                   SmaI 2961bp 698..698, MCS
FT                   2. pYAC4 SmaI-StuI 1795bp 592..2387, URA3
FT                   -> plasmid 4756bp
FT                   1. plasmid EcoRI-EcoRI 1813bp, URA3
FT                   \ pBluescript II KS+ 690..698..-..698..708
FT                   2. pHSSLysL EcoRI 7000bp, pUC19 397..397
FT                   -> pLUS 9500bp"
FT   promoter        0..0
FT                   /note="PRO T7"
FT   misc_binding    0..0
FT                   /note="MCS BamHI-KpnI-SacI-XbaI-HindIII"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 44 BP; 10 A; 10 C; 11 G; 13 T; 0 other;
     agcttctaga gctcggtacc ggatccctat agtgagtcgt atta
//