back Return to this vector's summary.
ID   PMFALPHA8  preliminary; circular DNA; SYN; 7000 BP.
XX
AC   ATCC40140; ATCC37418;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-APR-1995 (Rel. 11, Last updated, Version 1)
XX
DE   Saccharomyces/E.coli plasmid vector pMFalpha8 - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   M13-MFalpha1 from M13mp8 & MFalpha1
RC   pMFalpha4delta1 from M13-MFalpha1 & pUC8
RC   pMFalpha5 from pMFalpha4delta1 & oligo
RC   pTRP584 from yeast 2 micron origin & pTRP56
RC   pMFalpha8 from pMFalpha5 & pTRP584
RC   pMTG1 from pUC9 & pcD-IL-2
RC   pTG7 from pMFalpha8 & pMTG1
RA   Miyajima A., Bond M.W., Otsu K., Arai K., Arai N.;
RT   "Secretion of mature mouse interleukin-2 by Saccharomyces
RT   cerevisiae: use of a general secretion vector containing promoter
RT   and leader sequences of the mating pheromone alpha-factor";
RL   Gene 37:155-161(1985).
XX
RN   [2]
RC   pcD-IL-2 or MT-1, MT-18, MT-20, MT-28 from pcDV1 & pL1 & IL-2 gene
RA   Yokota T., Arai N., Lee F., Rennick D., Mosmann T., Arai K.;
RT   "Use of a cDNA expression vector for isolation of mouse
RT   interleukin-2 cDNA clones: expression of T-cell growth factor
RT   activity after transfection of monkey cells";
RL   Proc. Natl. Acad. Sci. U.S.A. 82:68-72(1985).
XX
CC   This was constructed by inserting a modified alpha promoter leader
CC   fragment into pTRP584, in which the StuI site in the TRP1-ARS1
CC   fragment is replaced with a PvuII site, so that the StuI site in the
CC   alpha factor processing region is unique.
CC   This is a Saccharomyces cerevisiae/E.coli shuttle vector with
CC   regulatory sequences to permit processing and secretion of eukaryotic
CC   proteins. The cloning sites are just downstream of the first
CC   processing site for the alpha factor leader.
CC   Shuttle expression vector permitting processing and secretion of
CC   eukaryotic proteins.  Cloning sites are immediately downstream of the
CC   first processing site for the alpha factor leader. Constructed by
CC   inserting a modified alpha promoter leader sequence into pTRP584,
CC   replacing the StuI site in the TRP1-ARS1 fragment with a PvuII site,
CC   so that the StuI site in the alpha factor processing region is unique.
CC   The order of the major features in this plasmid is: 2 micron ori -
CC   alpha factor leader - StuI - XhoI - TRP5 - EcoRI - pMB1 ori - ampR -
CC   EcoRI - ARS1 - PvuII - TRP1 - EcoRI. [1]
CC   Note: This material is cited in a U.S and/or other Patent and may not
CC   be used to infringe the patent claims.
CC   Medium is 1227 LB plus ampicillin.
CC   Deposited by: DNAX Research Inst. of Molecular and Cell. Biol,, Inc.
CC   NM (pMFalpha8)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)(DNAX Research Institute)
CC   HO (E.coli MC1061)(Saccharomyces cerevisiae)(E.coli)(E.coli HB101)
CC   CP ()
CC   FN (cloning)(shuttle)(expression)
CC   SE ()
CC   PA ()
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. M13mp8 EcoRI, MCS
FT                   2. yeast EcoRI-EcoRI 1700bp, MFalpha1 alpha factor
FT                   -> M13-MFalpha1
FT                   1. M13-MFalpha1
FT                   hybridize tcttttatccaaagataccc
FT                   Klenow fill in
FT                   S1 nuclease
FT                   EcoRI-EcoRI, MFalpha1 promoter/leader
FT                   2. pUC8 remove EcoRI-HindIII, MCS
FT                   :fill in
FT                   -> pMFalpha4delta1 [HindIII]
FT                   1. pMFalpha4delta1 HindIII
FT                   polymerase Ik fill in with only dA/dG
FT                   mung bean nuclease
FT                   2. oligo StuI-XhoI 10bp gcctcgaggc
FT                   -> pMFalpha5
FT                   1. yeast 2 micron PstI-XbaI, origin
FT                   2. pTRP56 ClaI
FT                   -> plasmid
FT                   1. plasmid StuI, ARS1/TRP1 gene
FT                   PvuII linker
FT                   -> pTRP584
FT                   1. pMFalpha5 BglII-XhoI, MFalpha1 promoter/leader
FT                   2. pTRP584 remove BamHI-XhoI, MCS
FT                   PvuII linker
FT                   -> pMFalpha8 [unique StuI in alpha factor]"
FT   misc_binding    0..0
FT                   /note="SIT unique StuI-XhoI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   rep_origin      0..0
FT                   /note="ORI yeast 2 micron"
FT   rep_origin      0..0
FT                   /note="ORI yeast ARS1"
FT   promoter        0..0
FT                   /note="PRO E. coli alpha factor gene"
FT   terminator      0..0
FT                   /note="TER yeast TRP5 gene"
FT   CDS             0..0
FT                   /note="ANT yeast TRP1 gene"
XX
SQ   Sequence 1 BP; 0 A; 0 C; 0 G; 0 T; 1 other;
     n
//