ID   PMSEX3     preliminary; circular DNA; SYN; 5600 BP.
XX
AC   ATCC37837;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Vertebrate/E.coli plasmid vector pMSEx-3 - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pMSE from pUC19 & SV40 early prom & MSV LTR & G418 & pHS272
RC   pMSEx1, pMSEx2, pMSEx3 from pMSE & oligo
RA   Schuermann M.;
RT   "An expression vector system for stable expression of oncogenes";
RL   Nucleic Acids Res. 18:4945-4946(1990).
XX
CC   Kanamycin resistance should be checked at regular intervals.  This is
CC   best done during amplification steps using LB medium supplemented with
CC   50 ug/ml ampicillin and 12.5 ug/ml kanamycin. (personal communication)
CC   One of 3 shuttle expression vectors (pMSEx-1-3, ATCC 37835-37837)
CC   containing a synthetic oligonucleotide providing a translation
CC   initiation signal, followed by a StuI site in 3 different positions,
CC   followed by a stop signal in all reading frames.
CC   The sequence of the oligonucleotide is:
CC   AGCTTGGTAC CATGGACGCT CGAGGCCTAG CTAGCTAGGAGCT.
CC   A EcoRI/HindIII digest gives fragments of 2.63, 1.68, 0.97 and 0.32
CC   kb. (personal communication)
CC   The SV40 promoter has a 3 bp deletion at the BglI site within the
CC   origin of replication to prevent autonomous replication in the
CC   presence of SV40 large T-antigen.
CC   The MSV LTR provides a polyadenylation signal as well as an enhancer
CC   for the P1/thymidine kinase promoter regulating the Tn5 kanR/G418R
CC   transcription unit.
CC   Restriction digests of the clone give the following sizes (kb):
CC   HindIII--3.2, 2.9; BglII--6.1; EcoRI/HindIII--2.8, 1.8, 1.0, 0.4;
CC   EcoRI--4.7, 1.4; consistent with deposited DNA. (ATCC staff)
CC   The order of the major features in this plasmid is:SV40 promoter -
CC   oligonucleotide/StuI/oligonucleotide - MLV-LTR - P1 promoter -
CC   TK promoter - kanR/G418R - TK polyadenylation signal - ampR.
CC   Medium is 1227 LB plus ampicillin.
CC   NM (pMSEx-3)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli HB101)(vertebrate cells)(E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA ()
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pMSE BamHI 5400bp
FT                   2. oligo HindIII-KpnI-StuI-SstI 43bp
FT                   \ agcttggtaccatggacgctcgaggcctagctagctaggagct
FT                   -> pMSEx3 5600bp"
FT   misc_binding    0..0
FT                   /note="SIT unique StuI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   promoter        0..0
FT                   /note="PRO SV40 early genes"
FT   CDS             0..0
FT                   /note="ANT E. coli kanamycin resistance gene (kan)"
FT   CDS             0..0
FT                   /note="ANT vertebrate G418 resistance gene (G418)"
XX
SQ   Sequence 43 BP; 9 A; 11 C; 14 G; 9 T; 0 other;
     agcttggtac catggacgct cgaggcctag ctagctagga gct
//