back Return to this vector's summary.
ID   PMTL20     preliminary; circular DNA; SYN; 2470 BP.
XX
AC   M21875; IG1350;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pMTL20 - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pMTL1 from pBR322
RC   pMTL2 from pMTL1
RC   pMTL3 from pMTL2 & pUC8
RC   pMTL4 from pMTL3
RC   [pMTL18 from M13mp18]
RC   [pMTL19 from M13mp19]
RC   pMTL20 from pMTL4 & M13mp18 & oligo
RC   pMTL21 from pMTL4 & M13mp19 & oligo
RC   pMTL22 from pMTL4 & M13mp18 & oligo
RC   pMTL23 from pMTL4 & M13mp19 & oligo
RC   pMTL24 from pMTL20 & pUC18
RC   pMTL25 from pMTL21 & pUC19
RC   pMTL26 from pMTL4 & M13mp19 & oligo
RC   pMTL20P from pMTL20 & pSC101, par
RC   pMTL21P from pMTL21 & pSC101, par
RC   pMTL18P from pMTL18 & pSC101, par
RC   pMTL19P from pMTL19 & pSC101, par
RC   pMTL22P from pMTL22 & pSC101, par
RC   pMTL23P from pMTL23 & pSC101, par
RC   pMTL24P from pMTL24 & pSC101, par
RC   pMTL25P from pMTL25 & pSC101, par
RC   pMTL26P from pMTL26 & pSC101, par
RA   Chambers S.P., Prior S.E., Barstow D.A., Minton N.P.;
RT   "The pMTL nic- cloning vectors, I. Improved pUC polylinker regions to
RT   facilitate the generation of sonicated DNA for nucleotide sequencing";
RL   Gene 68:139-149(1988).
XX
CC   NM (pMTL20)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pBRR322)
CC   BR (pMTL21)
CC   OF (pMTL20E)(pMTL20C)(pMTL500)(pMTL502)
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 remove BamHI-PvuII 1691bp 376..2067,
FT                   \ tet/2670bp
FT                   Klenow:
FT                   -> pMTL1 2670bp [unique BamHI]
FT                   1. pMTL1 remove HaeII-HaeII 622bp, rop/nic
FT                   \ pBR322 237..376..-..2067..2352/2048bp
FT                   -> pMTL2 2048bp [no NdeI at 2297]
FT                   1. pMTL2 remove TaqI-TaqI 1444bp, PstI/HincII in amp
FT                   \ pBR322 2574..4018
FT                   2. pUC8 TaqI-TaqI 1444bp 998..2442, amp gene
FT                   -> pMTL3 2048bp
FT                   1. pMTL3 remove AatII-RsaI 238bp 4286..164
FT                   T4 DNA polymerase:
FT                   -> pMTL4 1810bp
FT                   1. M13mp18 remove SalI-SphI 16bp 6264..6280,
FT                   \ MCS/7233bp
FT                   2. oligo SalI-SphI 37bp
FT                   \ tcgacgtcacgcgtccatggagatctcgaggcctgca
FT                   -> M13mt120 7270bp
FT                   1. pMTL4 HaeII 1810bp 0..0
FT                   2. M13mt120 HaeII-HaeII 466bp, lacZ gene
FT                   \ M13mp18 6005..6264..-..6280..6450 [540bp]
FT                   3. oligo 80bp
FT                   -> pMTL20 2470bp"
FT   misc_binding    0..0
FT                   /note="SIT unique EcoRV"
FT   misc_binding    0..0
FT                   /note="SIT unique HhaI"
FT   misc_binding    0..0
FT                   /note="SIT unique HpaI"
FT   CDS             complement(0..0)
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ)
FT                   alpha peptide"
FT   misc_binding    0..0
FT                   /note="MCS"
FT   promoter        complement(0..0)
FT                   /note="PRO E. coli lac gene"
FT   misc_binding    0..0
FT                   /note="SIT unique NspHI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             complement(0..0)
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
XX
SQ   Sequence 1 BP; 0 A; 0 C; 0 G; 0 T; 1 other;
     n
//