back Return to this vector's summary.
ID   PRS318     preliminary; circular DNA; SYN; 7400 BP.
XX
AC   ATCC77158;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Saccharomyces/E.coli phagemid vector pRS318 - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pRSS56 from pBluescript KS+ & BlueScribe
RC   pRS303 from pRSS56 & HIS3 gene
RC   pRS304 from pRSS56 & TRP1 gene
RC   pRS305 from pRSS56 & LEU2 gene
RC   pRS306 from pRSS56 & URA3 gene
RC   pUC19-CEN6:32 from pUC19 & CEN6
RC   pRSS83 from pUC19-CEN6:32 & pAB9, ARS
RC   pRSS84 from pRSS83
RC   pRS313 from pRS303 & pRSS84
RC   pRS314 from pRS304 & pRSS84
RC   pRS315 from pRS305 & pRSS84
RC   pRS316 from pRS306 & pRSS84
RC   pRSS93 from pRSS84 & pYCF5
RA   Sikorski R.S., Hieter P.;
RT   "A system of shuttle vectors and yeast host strains designed for
RT   efficient manipulation of DNA in Saccharomyces cerevisiae";
RL   Genetics 122:19-27(1989).
XX
CC   One of a series of pBluescript-based centromere vectors (ATCC 77142
CC   ATCC 77145, ATCC 77157 to ATCC 77158) differing in the yeast
CC   selectable marker gene. [1]
CC   pRSS56, constructed by ligating a PvuI fragment (bp 498-2412) of
CC   pBluescript KS+ to a PvuI fragment (bp 2850-730) of pBS(+), contains
CC   the KS MCS from pBluescript KS+ and the unique NdeI and AatII sites
CC   between bla and f1 origin of pBS(+). [1]
CC   YC-type centromere vector permitting visual detection of recombinants
CC   and production of ssDNA in E.coli.  Contains promoters for in vitro
CC   RNA synthesis, priming sites useful for sequencing, and encodes the
CC   lacZ alpha (lacZ') peptide. [1]
CC   Useful in plasmid shuffle experiments. [2]
CC   The order of the major features in this plasmid is: LEU2 - CYH2 -
CC   f1 ori - T7 promoter - lacZ'/MCS - T3 promoter - pMB1 ori - bla - CEN6
CC   - ARSH4. [2]
CC   Restriction digests of the clone give the following sizes (kb):
CC   HindIII--7.4; XbaI--7.4; PstI--7.4; BamHI--7.4. (ATCC staff)
CC   Medium is 1227 LB plus ampicillin.
CC   NM (pRS318)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (phagemid)
CC   SP (ATCC)
CC   HO (E.coli HB101)(Saccharomyces cerevisiae)(E.coli)
CC   HO (Saccharomyces cerevisiae YPH499)(Saccharomyces cerevisiae YPH500)
CC   HO (Saccharomyces cerevisiae YPH501)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA ()
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pUC19 HincII 2686bp 432..432
FT                   2. yeast MboII-MboII 125bp, CEN6
FT                   \ cttttcatcacgtgctataaaaataattataatttaaattttttaatata
FT                   \ aatatataaattaaaaatagaaagtaaaaaaagaaattaaagaaaaaata
FT                   \ gtttttgttttccgaagatgtaaaat
FT                   -> pUC19-CEN6:32 2811bp
FT                   1. pUC8 BamHI 2665bp 241..241
FT                   2. yeast Sau3AI/MboI-Sau3AI/MboI 374bp,
FT                   \ histone H4 ARS/ARSH4
FT                   -> pAB9 3039bp
FT                   1. pUC19-CEN6:32 ScaI-EcoRI 1908bp 397..-..2180, CEN6
FT                   2. pAB9 ScaI-EcoRI 1314bp 231..-..1171,
FT                   \ histone H4 ARS/ARSH4
FT                   -> pRSS83 3222bp [in MCS]
FT                   1. pRSS83 remove SmaI-XbaI 9bp 415..424, MCS/3213bp
FT                   Klenow:Klenow
FT                   -> pRSS84 3213bp
FT                   1. pRSS84 HincII-PstI, CEN6/ARSH4
FT                   T4 DNA polymerase:T4 DNA polymerase
FT                   2. pRS306 AatII 4373bp 4309..4309
FT                   T4 DNA polymerase:T4 DNA polymerase
FT                   -> pRS318 7400bp"
FT   misc_binding    0..0
FT                   /note="MCS KpnI-ApaI-XhoI-SalI-ClaI-HindIII-EcoRV-
FT                   EcoRI-PstI-SmaI-
FT                   BamHI-SpeI-XbaI-EagI-NotI-BstXI-SacII-SacI"
FT   misc_binding    0..0
FT                   /note="SIT unique ApaI-XhoI-SalI-HindIII-PstI-SmaI-
FT                   BamHI-SpeI-XbaI-NotI-SacI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   rep_origin      0..0
FT                   /note="ORI bacteriophage f1"
FT   rep_origin      0..0
FT                   /note="ORI yeast ARS H4"
FT   promoter        0..0
FT                   /note="PRO E. coli lac gene"
FT   promoter        0..0
FT                   /note="PRO bacteriophage T3"
FT   promoter        0..0
FT                   /note="PRO bacteriophage T7"
FT   CDS             0..0
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ');
FT                   reporter gene"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   CDS             0..0
FT                   /note="ANT yeast LEU2 gene"
FT   CDS             0..0
FT                   /note="ANT yeast CYH2 gene"
FT   misc_feature    0..0
FT                   /note="yeast centromere CEN6"
XX
SQ   Sequence 1 BP; 0 A; 0 C; 0 G; 0 T; 1 other;
     n
//