back Return to this vector's summary.
ID   PSHT       preliminary; circular DNA; SYN; 4000 BP.
XX
AC   ATCC77372;
XX
DT   03-FEB-1994 (Rel. 8, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Vertebrate/E.coli phagemid vector pSHT - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pUC119-ClaI from pUC119
RC   pSVTf from pSVT7 & pUC119-ClaI
RC   pSHT from pSVTf & oligo, HA signal sequence
RA   Madison E.L., Bird P.;
RT   "A vector, pSHT, for the expression and secretion of protein
RT   domains in mammalian cells";
RL   Gene 121:179-180(1992).
XX
RN   [2]
RC   pXKH from pko & pXf3
RC   pKC3 from pko & pUC8 & linker
RC   pSVT7 from pKC3 & T7 promoter
RC   pSVTCPY from pSVT7 & pTSY1
RC   pSVTHA from pSVT7
RC   M13mp18NEO from M13mp18 & Tn5
RC   M13mp19NEO from M13mp19 & Tn5
RC   M13mp18HA/NEO from M13mp18NEO & pMTHA
RC   M13mp19HA/NEO from M13mp19NEO & pMTHA
RC   M13mp18mHA/NEO from M13mp18HA/NEO
RC   M13mp19mHA/NEO from M13mp19HA/NEO
RC   pSVHA/NEO, pSVmHA/NEO from pXKH & M13mp19mHA/NEO
RC   pSVTCPY/HA from pSVTCPY & M13mp18 & pSVTHA
RC   pSVTHA/CPY from pSVTCPY & M13mp18HA/NEO & pSVT7
RA   Bird P., Gething M.J., Sambrook J.;
RT   "Translocation in yeast and mammalian cells: not all signal
RT   sequences are functionally equivalent";
RL   J. Cell Biol. 105:2905-2914(1987).
XX
RN   [3]
RC   from T7 promoter
RA   Sambrook J., Fritsch E.F., Maniatis T.;
RT   ;
RL   Molecular Cloning 0:0-0(1989).
RL   Sambrook J., Fritsch E.F., Maniatis T.;
RL   Cold Spring Harbor Laboratory, Cold Spring Harbor NY.
XX
RN   [4]
RC   virus from SV40 & influenza virus A/Japan/305/57 (H2N2) HA gene
RC   SV40-HAgenome from virus & pAT153
RC   SVEHA3 from SV40-HAgenome
RC   virus2 from SV40 & influenza virus A/Japan/305/57 (H2N2) HA gene
RC   SV40-HAgenome2 from virus2 & pAT153
RC   SVEHA8 from SV40-HAgenome2
RA   Gething M.J., Sambrook J.;
RT   "Cell-surface expression of influenza hemagglutin from a cloned
RT   DNA copy of the RNA gene";
RL   Nature 293:620-625(1981).
XX
RN   [5]
RC   plasmid from pBR322 & Tn5 & SV40 ori/early promoter
RC   pko from plasmid & SV40 small t intron & SV40 polyA
RC   pKO-neo from pko & plasmid2, Tn5 neo gene
RC   pACSE2 from SV40 early region
RC   pACSE2-neo from pKO-neo & pACSE2
RC   Ad5-neoR1, Ad5-neoR2 from pACSE2-neo & deltaE1/X, adenovirus 5
RA   Van Doren K., Hanahan D., Gluzman Y.;
RT   "Infection of eukaryotic cells by helper-independent recombinant
RT   adenoviruses: early region 1 is not obligatory for integration of
RT   viral DNA";
RL   J. Virol. 50:606-614(1984).
XX
RN   [6]
RC   pTSY1 from PRC1 gene
RA   Stevens T.;
RT   ;
RL   Unpublished (1987).
XX
RN   [7]
RC   pBPV69X from pPX & pBPV-H11 & linker
RC   pPX from pXf3 & SV40 & linker
RC   pMTH3 from pJYM-MMT1a & linker & pPX
RC   pSVHA, pSVHAsec from pPX & human influenza virus hemagglutin gene
RC   pMTHA from pMTH3 & pSVHA, HA signal sequence
RC   pMTHAsec from pMTH3 & pSVHAsec, HA signal sequence
RC   p69SVHA from pSVHA & pBPV-H11
RC   p69SVHAsec from pSVHAsec & pBPV-H11
RC   p69MTHA from pMTHA & pBPV-H11
RC   pBV1MTHA from pMTHA & pBPV-H11
RC   pBV1MTHAsec from pMTHAsec & pBPV-H11
RA   Sambrook J., Rodgers L., White J., Gething M.J.;
RT   "Lines of BPV-transformed murine cells that constitutively express
RT   influenza virus hemagglutin";
RL   EMBO J. 4:91-103(1985).
XX
RN   [8]
RC   sub304 from adenovirus 5
RC   from sub304
RC   [deltaE1/X from sub304]
RA   Jones N., Shenk T.;
RT   "Isolation of adenovirus type 5 host range deletion mutants
RT   defective for transformation of rat embryo cells";
RL   Cell 17:683-689(1979).
XX
RN   [9]
RC   plasmid from Tn5 neo gene
RA   DiMaio D.;
RT   ;
RL   Unpublished (1984).
XX
RN   [10]
RC   pJYM-MMT1a from pJYM & mouse MT gene
RA   Hamer D.H., Walling M.J.;
RT   "Regulation in vivo of a cloned mammalian gene: cadmium induces
RT   the transcription of a mouse metallothionein gene in SV40
RT   vectors";
RL   J. Mol. Appl. Genet. 1:273-288(1982).
XX
RN   [11]
RC   pON3 from SV40 early gene promoter & Tn5
RA   Hanahan D.;
RT   ;
RL   Unpublished (1985).
XX
CC   Deposited by: Phillip Bird
CC   Shuttle expression vector providing a start codon and signal sequence
CC   (from influenza virus hemagglutinin HA) necessary to express membrane
CC   and secretory proteins in mammalian cells. [1]
CC   Contains stop codons in all three frames after cloning sites. [1]
CC   The order of the major features in the phagemid is: pMB1 ori - ampR -
CC   M13 ori - ClaI - SV40 ori - SV40 early promoter - T7 promoter -
CC   HindIII - HA signal sequence - BamHI/SmaI/SpeI - termination signals -
CC   EcoRI - NheI- SV40 intron - BclI - SV40 polyadenylation. [1]
CC   Restriction digests of the clone give the following sizes (kb):
CC   SmaI--4.0; BamHI--4.0; HindIII--4.0. (ATCC staff)
CC   Medium is 1227 LB plus ampicillin.
CC   NM (pSHT)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (phagemid)
CC   SP (ATCC)
CC   HO (E.coli)(E.coli HB101)(vertebrate cells)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA ()
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 remove small EcoRI-HindIII 31bp
FT                   \ 4360..4361..30, 4330bp
FT                   2. E. coli AluI-EcoRI 95bp, lacUV5 promoter/#Y00412
FT                   \ ctcactcattaggcaccccaggctttacactttatgcttccggctcgtat
FT                   \ aatgtgtggaattgtgagcggataacaatttcacacaggaaacag
FT                   3. SV40 HindIII-PvuII 344bp 5172..5243..273,
FT                   \ ori/early promoter
FT                   -> plasmid 4769bp
FT                   1. plasmid BamHI-HindIII 4423bp, SV40 ori/early prom
FT                   \ 376..4360..-..- [remove 346bp 30..376]
FT                   2. SV40 MboII-MboII 610bp 4101..4711, intron [615bp]
FT                   Klenow:Klenow
FT                   HindIII linker 10bp nnaagcttnn:HindIII linker 10bp
FT                   \ nnaagcttnn
FT                   HindIII-HindIII 615bp
FT                   HinfI-HindIII 141bp 4570..4711, SV40 small t intron
FT                   \ [147bp]
FT                   3. SV40 BamHI-HinfI 291bp 2534..2825, polyA
FT                   -> pko 4855bp
FT                   1. pko AvaI-EcoRI 3805bp, ori/amp gene
FT                   \ pBR322 1426..4360 [remove 1050bp 376..1426]
FT                   2. pUC8 PvuII-EcoRI 2540bp 356..2665..231, ori/amp
FT                   -> plasmid2 6345bp
FT                   1. plasmid2 PvuII 6345bp, 5' to SV40 ori
FT                   ClaI linker 6bp atcgat
FT                   -> plasmid3 6345bp
FT                   1. plasmid3 HindIII 6345bp, 3' to SV40 intron
FT                   2. linker MCS 78bp
FT                   \ HindIII-EcoRI-SacI-SmaI-BamHI-XbaI-SalI-PstI-HindIII
FT                   \ tggatggccatcatttatctcattctcctgttcacagcatgagagggg
FT                   \ atcccgggactagttaactaagaattcgct
FT                   -> pKC3 6423bp
FT                   1. pKC3 StuI 6423bp, 5' to MCS in SV40 early
FT                   2. oligo StuI-StuI 20bp, T7 promoter
FT                   -> pSVT7 3800bp
FT                   1. pUC119 NarI 3162bp 713..713
FT                   ClaI linker 6bp atcgat
FT                   -> pUC119-ClaI 3162bp
FT                   1. pSVT7 ScaI-ClaI 2000bp, 5' amp gene
FT                   2. pUC119-ClaI ScaI-ClaI 1943bp 713..2656,
FT                   \ 5' amp gene/M13 ori
FT                   -> pSVTf 4000bp
FT                   1. pSVTf BamHI 4000bp
FT                   fill in
FT                   HindIII 4000bp
FT                   2. oligo, HA signal sequence
FT                   -> pSHT 4000bp"
FT   misc_binding    0..0
FT                   /note="MCS unique BamHI-SmaI-SpeI"
FT   misc_binding    0..0
FT                   /note="SIT EcoRI"
FT   misc_binding    0..0
FT                   /note="SIT NheI"
FT   misc_feature    0..0
FT                   /note="PRO SV40 t antigen intron"
FT   misc_binding    0..0
FT                   /note="SIT BclI"
FT   terminator      0..0
FT                   /note="PRO SV40 polyA"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   misc_binding    0..0
FT                   /note="SIT ScaI"
FT   rep_origin      0..0
FT                   /note="ORI bacteriophage M13"
FT   misc_binding    0..0
FT                   /note="SIT ClaI"
FT   rep_origin      0..0
FT                   /note="ORI SV40"
FT   promoter        0..0
FT                   /note="PRO SV40 early genes"
FT   promoter        0..0
FT                   /note="PRO bacteriophage T7"
FT   misc_binding    0..0
FT                   /note="SIT HindIII"
FT   misc_feature    0..0
FT                   /note="HA signal sequence"
XX
SQ   Sequence 78 BP; 19 A; 18 C; 18 G; 23 T; 0 other;
     tggatggcca tcatttat ctcattctcc tgttcacagc atgagagggg atcccgggac
     tagttaacta agaattcg ct
//