back Return to this vector's summary.
ID   PUC21      preliminary; circular DNA; SYN; 144 BP.
XX
AC   M74307;
XX
DT   05-AUG-1991 (Rel. 6, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pUC21 - incomplete, MCS.
XX
KW   cloning vector; MCS.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-144
RC   MCS from pMTL23 & pBluescript SK
RC   pUC21 from pUC118 & linker MCS
RC   pUK21 from pUC21 & Tn903
RC   pUC6S from MCS & pUC6; [pUC with no lacZ]
RC   pOK12 from pUC21 & Tn903 & pACYC177
RA   Vieira J., Messing J.;
RT   "New pUC-derived cloning vectors with different selectable markets
RT   and DNA replication origins";
RL   Gene 100:189-194(1991).
XX
CC   NCBI gi: 209215
CC   NM (pUC21)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (phagemid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pUC118)(pMTL23)(pSK from Stratagene)
CC   BR ()
CC   OF (pUK21)(pOK12)
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 remove BamHI-PvuII 1691bp 376..2067,
FT                   \ tet/2670bp
FT                   Klenow:
FT                   -> pMTL1 2670bp [unique BamHI]
FT                   1. pMTL1 remove HaeII-HaeII 622bp, rop/nic
FT                   \ pBR322 1730..2352/2048bp
FT                   -> pMTL2 2048bp [no NdeI at 2297]
FT                   1. pMTL2 remove TaqI-TaqI 1444bp, PstI/HincII in amp
FT                   \ pBR322 2574..4018
FT                   2. pUC8 TaqI-TaqI 1444bp 998..2442, amp gene
FT                   -> pMTL3 2048bp
FT                   1. pMTL3 AatII-RsaI 238bp 4286..164
FT                   T4 DNA polymerase:
FT                   -> pMTL4 1810bp
FT                   1. M13mp19 remove SphI-SalI 8bp 6245..6253, MCS/7241bp
FT                   2. oligo StuI-AatII 29bp
FT                   \ ggcctcgagatctccatggacgcgtgacg
FT                   -> M13mt121 7270bp
FT                   1. pMTL4 HaeII 1810bp 0..0
FT                   2. M13mt121 HaeII-HaeII 540bp, lacZ gene
FT                   3. oligo 80bp
FT                   \ ccaagctcgcgaggcctcgagatctatcgatgcatgccatggtacccggg
FT                   \ agctcgaattctagaagcttctgcagacgcgtcgacgtcatatggatccg
FT                   \ atatcgccggcaattca
FT                   -> pMTL23 2500bp
FT                   1. pMTL23, MCS
FT                   2. pBluescript SK, MCS/T7
FT                   -> MCS linker 144bp
FT                   1. pUC118 3162bp
FT                   2. MCS linker 144bp
FT                   \ atgaccatgattacgccactagtccgaggcctcgagatctatcgatgcat
FT                   \ gccatggtacccgggagctcgaattcgaagcttctgcagacgcgtcgacg
FT                   \ tcatatggatccgatatcgccgtggcggccgctctagaactagt
FT                   -> pUC21 3306bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 144 BP; 32 A; 41 C; 39 G; 32 T; 0 other;
     atgaccatga ttacgccact agtccgaggc ctcgagatct atcgatgcat gccatggtac
     ccgggagctc gaattcgaag cttctgcaga cgcgtcgacg tcatatggat ccgatatcgc
     cgtggcggcc gctctagaac tagt
//