back Return to this vector's summary.
ID   PUR19N     preliminary; circular DNA; SYN; 5500 BP.
XX
AC   ATCC77300;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Schizosaccharomyces/E.coli plasmid vector pUR19N - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pUR18 from pUC18 & pFL201.2
RC   pUR19 from pUC19 & pFL201.2
RC   pUR18N from pUR18
RC   pUR19N from pUR19
RC   pUC-DIS from pUC18
RC   pUD18 from ura4
RA   Barbet N., Muriel W.J., Carr A.M.;
RT   "Versatile shuttle vectors and genomic libraries for use with
RT   Schizosaccharomyces pombe";
RL   Gene 114:59-66(1992).
XX
CC   Shuttle vector permitting visual detection of recombinants by
CC   beta-galactosidase alpha complementation.
CC   The addition of NotI and SfiI sites to the MCS enables unidirectional
CC   exonuclease III deletions & facilitates the rescue in E. coli of
CC   plasmids where dimerization has occurred.
CC   The order of the major features in this plasmid is: ura4 - ars1 -
CC   SfiI/MCS/HindIII/lacZ' - pMB1 ori - ampR.
CC   Restriction digests of the clone give the following sizes (kb):
CC   EcoRI--5.5; BamHI--5.5; HindIII--5.5; PstI--5.5. (ATCC staff)
CC   Medium is 1227 LB plus ampicillin.
CC   NM (pUR19N)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli DH5alpha)(Schizosaccharomyces pombe)(E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA ()
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pUR19 remove EcoRI-KpnI 16bp, MCS
FT                   \ pUC19 397..413/5500bp
FT                   2. oligo EcoRI-KpnI 43bp
FT                   \ aattggccctcgaggccagcggccgcgaattcgagctcggtac
FT                   -> pUR19N 5500bp"
FT   misc_binding    0..0
FT                   /note="MCS SfiI-NotI-EcoRI-SacI-KpnI-SmaI-BamHI-
FT                   XbaI-HincII-AccI-SalI-PstI-SphI-HindIII"
FT   misc_binding    0..0
FT                   /note="SIT unique SfiI-NotI-EcoRI-SacI-KpnI-SmaI-
FT                   BamHI-HincII-SalI-PstI-SphI-HindIII"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   rep_origin      0..0
FT                   /note="ORI yeast ARS1"
FT   promoter        0..0
FT                   /note="PRO E. coli lac gene"
FT   CDS             0..0
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ');
FT                   reporter gene"
FT   CDS             0..0
FT                   /note="ANT yeast URA4 gene"
XX
SQ   Sequence 43 BP; 8 A; 14 C; 14 G; 7 T; 0 other;
     aattggccct cgaggccagc ggccgcgaat tcgagctcgg tac
//