back Return to this vector's summary.
ID   PVT100L    preliminary; circular DNA; SYN; 161 BP.
XX
AC   M16320;
XX
DT   01-SEP-1988 (Rel. 3, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pVT100-L - incomplete, MCS.
XX
KW   cloning vector; MCS.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-161
RC   pMH158delta from pMH158
RC   pMH158/ADNdelta from pMH158delta & pAAH5
RC   pVT95-L, pVT96-L from pMH158/ADNdelta & linker
RC   pVT97-L, pVT98-L from pVT95-L & pEMBL8+
RC   pVT100-L from pVT97-L & linker
RC   pVT101-L from pVT98-L & linker
RC   pVT99-L from pVT96-L & linker
RC   pVT102-L, pVT103-L from pVT99-L & pEMBL8+
RC   pVT-100Ldeltaleu2-d from pVT100-L & linker
RC   pVT-101Ldeltaleu2-d from pVT101-L & linker
RC   pVT-102Ldeltaleu2-d from pVT102-L & linker
RC   pVT-103Ldeltaleu2-d from pVT103-L & linker
RC   pVT-100U from pVT-100Ldeltaleu2-d & pFL44L
RC   pVT-101U from pVT-101Ldeltaleu2-d & pFL44L
RC   pVT-102U from pVT-102Ldeltaleu2-d & pFL44L
RC   pVT-103U from pVT-103Ldeltaleu2-d & pFL44L
RA   Vernet T., Dignard D., Thomas D.Y.;
RT   "A family of yeast expression vectors containing the phage f1
RT   intergenic region";
RL   Gene 52:225-233(1987).
XX
RN   [2]
RP   1-161
RC   pVT100-L
RA   Vernet T.;
RT   ;
RL   Submitted (09-SEP-1988) by:
RL   Vernet T., .
XX
RN   [3]
RC   pVT20 from pBB59, colE3 gene
RC   pVT21 from pBR327 & pVT20
RC   pVT22 from pVT21 & linker
RC   pVT23 from pVT22 & lambda
RC   pVT24 from pVT23 & linker
RC   pVT25 from pVT24
RC   pVT26 from pBB52 & lambda
RC   pVT27, pVT27-1 from pVT25 & pSI-BCA4, human proinsulin gene
RA   Vernet T., Lau P.C., Narang S.A., Visentin L.P.;
RT   "A direct-selection vector derived from pColE3-CA38 and adapted for
RT   foreign gene expression";
RL   Gene 34:87-93(1985).
XX
RN   [4]
RC   pJDB207 from pJDB219 & LEU2 gene
RC   pJRD158b from pJRD158
RC   pMH158 from pJDB207 & pJRD158b
RC   pJO158 from YRp7 & pJRD158
RA   Heusterspreute M., Oberto J., Ha-Thi V., Davison J.;
RT   "Vectors with restriction-site banks, III. Escherichia
RT   coli-Saccharomyces cerevisiae shuttle vectors";
RL   Gene 34:363-366(1985).
XX
RN   [5]
RC   ColE3-CA38 from E. coli colE3 gene
RA   Watson R., Visentin L.P.;
RT   "Restriction endonuclease mapping of ColE2-P9 and ColE3-CA38
RT   plasmids";
RL   Gene 10:307-318(1980).
XX
RN   [6]
RC   pBB52 from ColE3-CA38, E. coli colE3 gene
RC   pBB59 from ColE3-CA38, E. coli colE3 gene
RA   Watson R.J., Visentin L.P.;
RT   "Cloning of the ColE3-CA38 colicin and immunity genes and
RT   identification of a plasmid region which enhances colicin production";
RL   Gene 19:191-200(1982).
XX
RN   [7]
RC   pSI-BCA4 from human proinsulin gene
RA   Brousseau R., Scarpulla R., Sung W., Hsiung H.M., Narang S.A., Wu R.;
RT   "Synthesis of a human insulin gene, V. Enzymatic assembly, cloning
RT   and characterization of the human proinulin DNA";
RL   Gene 17:279-289(1982).
XX
CC   NCBI gi: 209226
CC   NM (pVT100-L)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pVT102-L)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pMB9 EcoRI 5300bp, 5' to tet gene
FT                   2. yeast 2 micron B form EcoRI-EcoRI 2235bp
FT                   \ 2408..3942 & 703..2
FT                   \ UL = 3239bp 703..3942 US = 3079bp 3942..6318..703 A
FT                   \ UL = 3239bp 703..3942 US = 3079bp 703..6318..3942 B
FT                   -> pJBD41 7500bp [tet gene]
FT                   1. pJBD41 PstI 7500bp, amp gene
FT                   \ yeast 2 micron 2657..2657
FT                   dAT tailing
FT                   2. yeast 1200bp, LEU2 gene
FT                   sheared
FT                   dAT tailing
FT                   -> pJDB219 8700bp [HindIII-HindIII 3600bp, ori/leu2]
FT                   1. pJDB219 PstI 8700bp
FT                   dAT tailing
FT                   2. yeast 1200bp, LEU2 gene with no promoter
FT                   dAT tailing t(31)atatatattt-LEU2-tatttgtaca(47)
FT                   -> pJDB207 9900bp
FT                   1. pJRD158 3903bp
FT                   -> pJRD158b 3900bp
FT                   1. pJDB207 XbaI 9900bp
FT                   Klenow
FT                   remove BclI-Sau3A 212bp tca| gatcgtac...tacct |gatcac
FT                   remove EcoRI-EcoRI, pAT153
FT                   2. pJRD158b EcoRI 3900bp 3902..3902
FT                   -> pMH158 7170bp [tet, amp, LEU2]
FT                   1. pMH158 remove NdeI-XhoI 2200bp, 5000bp
FT                   2. SphI linker 11bp tatcgcatgcg
FT                   -> pMH158delta 5000bp
FT                   1. pMH158delta SphI 5000bp
FT                   2. pAAH5 SphI-SphI 728bp
FT                   -> pMH158/ADNdelta 5700bp
FT                   1. pMH158/ADNdelta HindIII 5700bp
FT                   alkaline phosphatase
FT                   2. HindIII-PvuII-BamHI linker 16bp agcttcagctggatcc
FT                   -> pVT95-L 5700bp
FT                   1. pVT95-L StuI 5700bp
FT                   2. pEMBL8+ RsaI-RsaI 514bp 771..1285, phage f1 ori
FT                   -> pVT97-L 6300bp
FT                   1. pVT97-L HindIII-BamHI 6300bp
FT                   2. linker BamHI-XbaI-SstI-XhoI-PstI-PvuII-HindIII
FT                   \ 161bp
FT                   \ tggcaaggtagacaagccgacaaccttgattggagacttgaccaaacctc
FT                   \ tggcgaagaagtccaaagctggatcctctagacgagctcctcgagcctgc
FT                   \ agcagctgaagcttggagttgattgtatgcttggtatagcttgaaatatt
FT                   \ gtgcagaaaaa
FT                   -> pVT100-L 6300bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 161 BP; 47 A; 34 C; 43 G; 37 T; 0 other;
     tggcaaggta gacaagccga caaccttgat tggagacttg accaaacctc tggcgaagaa
     gtccaaagct ggatcctcta gacgagctcc tcgagcctgc agcagctgaa gcttggagtt
     gattgtatgc ttggtatagc ttgaaatatt gtgcagaaaa a
//