back Return to this vector's summary.
ID   PVT102L    preliminary; circular DNA; SYN; 65 BP.
XX
AC   M16469;
XX
DT   01-SEP-1988 (Rel. 3, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pVT102-L - incomplete, MCS.
XX
KW   cloning vector; MCS.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-65
RC   pMH158delta from pMH158
RC   pMH158/ADNdelta from pMH158delta & pAAH5
RC   pVT95-L, pVT96-L from pMH158/ADNdelta & linker
RC   pVT97-L, pVT98-L from pVT95-L & pEMBL8+
RC   pVT100-L from pVT97-L & linker
RC   pVT101-L from pVT98-L & linker
RC   pVT99-L from pVT96-L & linker
RC   pVT102-L, pVT103-L from pVT99-L & pEMBL8+
RC   pVT-100Ldeltaleu2-d from pVT100-L & linker
RC   pVT-101Ldeltaleu2-d from pVT101-L & linker
RC   pVT-102Ldeltaleu2-d from pVT102-L & linker
RC   pVT-103Ldeltaleu2-d from pVT103-L & linker
RC   pVT-100U from pVT-100Ldeltaleu2-d & pFL44L
RC   pVT-101U from pVT-101Ldeltaleu2-d & pFL44L
RC   pVT-102U from pVT-102Ldeltaleu2-d & pFL44L
RC   pVT-103U from pVT-103Ldeltaleu2-d & pFL44L
RA   Vernet T., Dignard D., Thomas D.Y.;
RT   "A family of yeast expression vectors containing the phage f1
RT   intergenic region";
RL   Gene 52:225-233(1987).
XX
RN   [2]
RP   1-161
RC   pVT102-L
RA   Vernet T.;
RT   ;
RL   Submitted (09-SEP-1988) by:
RL   Vernet T., .
XX
CC   NCBI gi: 209227
CC   NM (pVT102-L)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pVT102-L)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pMB9 EcoRI 5300bp, 5' to tet gene
FT                   2. yeast 2 micron B form EcoRI-EcoRI 2235bp
FT                   \ 2408..3942 & 703..2
FT                   \ UL = 3239bp 703..3942 US = 3079bp 3942..6318..703 A
FT                   \ UL = 3239bp 703..3942 US = 3079bp 703..6318..3942 B
FT                   -> pJBD41 7500bp [tet gene]
FT                   1. pJBD41 PstI 7500bp, amp gene
FT                   \ yeast 2 micron 2657..2657
FT                   dAT tailing
FT                   2. yeast 1200bp, LEU2 gene
FT                   sheared
FT                   dAT tailing
FT                   -> pJDB219 8700bp [HindIII-HindIII 3600bp, ori/leu2]
FT                   1. pJDB219 PstI 8700bp
FT                   dAT tailing
FT                   2. yeast 1200bp, LEU2 gene with no promoter
FT                   dAT tailing t(31)atatatattt-LEU2-tatttgtaca(47)
FT                   -> pJDB207 9900bp
FT                   1. pJRD158 3903bp
FT                   -> pJRD158b 3900bp
FT                   1. pJDB207 XbaI 9900bp
FT                   Klenow
FT                   remove BclI-Sau3A 212bp tca| gatcgtac...tacct |gatcac
FT                   remove EcoRI-EcoRI, pAT153
FT                   2. pJRD158b EcoRI 3900bp 3902..3902
FT                   -> pMH158 7170bp [tet, amp, LEU2]
FT                   1. pMH158 remove NdeI-XhoI 2200bp, 5000bp
FT                   2. SphI linker 11bp tatcgcatgcg
FT                   -> pMH158delta 5000bp
FT                   1. pMH158delta SphI 5000bp
FT                   2. pAAH5 SphI-SphI 728bp
FT                   -> pMH158/ADNdelta 5700bp
FT                   1. pMH158/ADNdelta HindIII 5700bp
FT                   alkaline phosphatase
FT                   2. HindIII-PvuII-BamHI linker 16bp agcttcagctggatcc
FT                   -> pVT96-L 5700bp
FT                   1. pVT96-L HindIII-BamHI 5700bp
FT                   2. linker HindIII-PvuII-PstI-XhoI-SstI-XbaI-BamHI 65bp
FT                   \ aagcttcagctgctgcaggctcgaggagctcgtctagaggatccagcttg
FT                   \ gagttgattgtatgc
FT                   -> pVT99-L 5700bp
FT                   1. pVT99-L StuI 5700bp
FT                   2. pEMBL8+ RsaI-RsaI 514bp 771..1285, phage f1 ori
FT                   -> pVT102-L 6400bp"
FT   rep_origin      0..0
FT                   /note="ORI"
XX
SQ   Sequence 65 BP; 13 A; 14 C; 21 G; 17 T; 0 other;
     aagcttcagc tgctgcaggc tcgaggagct cgtctagagg atccagcttg gagttgattg
     tatgc
//