back Return to this vector's summary.
ID   PW8        preliminary; circular DNA; SYN; 147 BP.
XX
AC   X05401;
XX
DT   06-JUL-1989 (Rel. 4, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Drosophila/E.coli plasmid vector pW8 - incomplete, MCS.
XX
KW   cloning vector; Drosophila melanogaster; polylinker; P element;
KW   germ line transformation; hsp70-white.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-147
RC   pW1 from pUC18 & pWP-2
RC   pW2 from pW1
RC   pW3 from pW2
RC   pW4 from pW3 & pHSL
RC   car4.3 from Carnegie 4 & linker
RC   pW5, pW6 from pW4 & car4.3
RC   pW7 from pW5 & linker
RC   pW8 from pW7 & linker
RC   pWAc from pW5 & p75RH, indirect flight muscle specific actin gene
RA   Klemenz R., Weber U., Gehring W.J.;
RT   "The white gene as a marker in a new P-element vector for gene
RT   transfer in Drosophila";
RL   Nucleic Acids Res. 15:3947-3959(1987).
XX
RN   [2]
RC   delta1 from Charon 4 & Drosophila DNA
RC   M363, M407, M410, M505, M510, M512, M558, M570 from delta1, white
RA   Goldberg M.L., Paro R., Gehring W.J.;
RT   "Molecular cloning of the white locus region of Drosophila
RT   melanogaster usign a large transposable element";
RL   EMBO J. 1:93-98(1982).
XX
RN   [3]
RC   p6.3 from p6.1 & pUC9
RC   pWP-2 from phage M558 & p6.3, P element
RA   Gehring W.J., Klemenz R., Weber U., Kloter U.;
RT   "Functional analysis of the white+ gene of Drosophila by
RT   P-factor-mediated transformation";
RL   EMBO J. 3:2077-2085(1984).
XX
RN   [4]
RC   pHSPr from pAT153 & p56H8, hsp70 gene
RC   pHSL from pAT153 & p56H8, hsp70 gene
RC   pAH from sAC-1 & pHSPr
RC   pAHdelta from pAH
RC   pCAH from pAHdelta & Carnegie 20 or car20, rosy gene/P element
RC   pCadh from sAC-1 & Carnegie 20 or car20, rosy gene/P element
RC   sAC-1delta from sAC-1
RC   pHSLdelta1, pHSLdelta2 from pHSL
RC   p70A1 from pHSLdelta1 & sAC-1delta
RC   p70A2 from pHSLdelta2 & sAC-1delta
RC   pC70A1 from p70A1 & Carnegie 20 or car20
RC   pC70A2 from p70A2 & Carnegie 20 or car20
RA   Klemenz R., Hultmark D., Gehring W.J.;
RT   "Selective translation of heat shock mRNA in Drosophila
RT   melanogaster depends on sequence information in the leader";
RL   EMBO J. 4:2053-2060(1985).
XX
RN   [5]
RC   p111F2, p56H8, p132E3 from pSF2124 & Drosophila hsp70 gene
RA   Schedl P., Artavanis-Tsakonas S., Steward R., Gehring W.,
RA   Mirault M.E., Goldschmidt-Clermont M., Moran L., Tissieres A.;
RT   "Two hybrid plasmids with D. melanogaster DNA sequences
RT   complementary to mRNA coding for the major heat shock protein";
RL   Cell 14:921-929(1978).
XX
RN   [6]
RC   pAG1 from pSKS106 & act88F gene
RC   pAGH1 from pAG1 & polyA
RC   pCSRH from pAT153 & P element
RC   p75RH from pAT153 & KM75 gene
RC   pHSS6 from pUC18 & HH5 gene
RC   P[ry.75A], P[ry.75B], P[ry.75C] from Carnegie 20 & act88F gene
RC   P[ry.75D], P[ry.75E], P[ry.75F] from Carnegie 20 & act88F gene
RC   P[ry.CSA], P[ry.CSB], P[ry.CSC] from Carnegie 20 & act88F gene
RC   P[ry.CS-75], P[ry.75-CS], P[ry.CS-5] from Carnegie 20 & act88F gene
RC   P[ry.CSdeltaK], P[ry.AGH] from Carnegie 20 & act88F gene
RC   P[ry.AGH] from Carnegie 20 & pAGH1
RA   Hiromi Y., Okamoto H., Gehring W.J., Hotta Y.;
RT   "Germline transformation with Drosophila mutant actin genes
RT   induces constitutive expression of heat shock genes";
RL   Cell 44:293-301(1986).
XX
RN   [7]
RC   pAT365.2 from pAT153 & pWP-2
RA   Fjose A.;
RT   ;
RL   Unpublished (1984).
XX
RN   [8]
RC   sAC-1 from ADH2 gene
RA   Goldberg D.A.;
RT   "Isolation and partial characterization of the Drosophila alcohol
RT   dehydrogenase gene";
RL   Proc. Natl. Acad. Sci. U.S.A. 77:5794-5798(1980).
XX
CC   P element mediates germ line transformation of Drosophila
CC   melanogaster.
CC   NCBI gi: 58137
CC   NM (pW8)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (Drosophila melanogaster P element)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pSF2124 R1 10900bp
FT                   poly(dT) connector
FT                   2. Drosophila hsp70 gene
FT                   poly(dAT) connector
FT                   -> p56H8
FT                   1. pAT153 remove EcoRI-BamHI 377bp 3657..3658..376,
FT                   \ 3281bp
FT                   2. p56H8 EcoRI-BamHI, hsp70 gene
FT                   -> pHSL
FT                   1. p6.1 remove EcoRI-BamHI 377bp 4360..4361..376,
FT                   \ [375bp]
FT                   S1 nuclease
FT                   XhoI, Drosophila
FT                   Klenow
FT                   2. pUC9 HindIII-HaeIII/FnuDI 40bp 234..274
FT                   Klenow
FT                   -> p6.3 [unique EcoRI, SamI, BamHI in P element]
FT                   1. phage M558 EcoRI-EcoRI 12000bp, w+ locus
FT                   2. p6.3 EcoRI, MCS
FT                   -> pWP-2
FT                   1. pUC18 SalI 2686bp 418..418
FT                   Klenow:Klenow
FT                   2. pWP-2 MaeI-HindIII 535bp 3707..3172
FT                   Klenow:Klenow
FT                   -> pW1 3220bp
FT                   1. pW1 XbaI-EcoRI
FT                   2. pWP-2 KpnI, 3' to white gene
FT                   BAL31 nuclease, remove 2200bp at 4400
FT                   XbaI-EcoRI
FT                   -> pW2
FT                   1. pW2 XbaI
FT                   Klenow
FT                   -> pW3 [no XbaI]
FT                   1. pW3 PstI
FT                   T4 DNA polymerase:T4 DNA polymerase
FT                   2. pHSL HaeIII-XmnI 388bp, hsp70 promoter/leader
FT                   -> pW4
FT                   1. Carnegie 4 SalI
FT                   fill in
FT                   XhoI linker 8bp cctcgagg
FT                   SacI
FT                   T4 DNA polymerase
FT                   KpnI linker 8bp gggtaccc
FT                   BamHI
FT                   fill in
FT                   BglII linker 8bp cagatctg
FT                   -> car4.3
FT                   1. pW4 HindIII-EcoRI
FT                   Klenow:Klenow
FT                   2. car4.3 HindIII, MCS
FT                   Klenow:Klenow
FT                   -> pW5
FT                   1. pW5 XhoI
FT                   fill in
FT                   HpaI linker 6bp gttaac
FT                   -> pW7
FT                   1. pW7 BglII
FT                   2. NotI-SacII-SfiI-SpeI linker 147bp
FT                   \ gaattcggtacccgcccgggatcagatccgcggccgcataggccactagt
FT                   \ ggatctggatcctctagagtcgacctcgaacgttaacgttaacgtaacgt
FT                   \ taactcgaggcctcgaggtcgacctgcagccaagctacgttgcatgc
FT                   -> pW8"
FT   misc_feature    1..6
FT                   /note="SIT unique EcoRI"
FT   misc_feature    7..12
FT                   /note="SIT unique KpnI"
FT   misc_feature    15..20
FT                   /note="SIT unique SmaI"
FT   misc_feature    28..33
FT                   /note="SIT unique SacII"
FT   misc_feature    30..37
FT                   /note="SIT unique NotI"
FT   misc_feature    32..44
FT                   /note="SIT unique SfiI"
FT   misc_feature    45..50
FT                   /note="SIT unique SpeI"
FT   misc_feature    57..62
FT                   /note="SIT unique BamHI"
FT   misc_feature    63..68
FT                   /note="SIT unique XbaI"
FT   misc_feature    69..74
FT                   /note="SIT SalI"
FT   misc_feature    82..87
FT                   /note="SIT HpaI"
FT   misc_feature    88..93
FT                   /note="SIT HpaI"
FT   misc_feature    99..104
FT                   /note="SIT HpaI"
FT   misc_feature    104..109
FT                   /note="SIT XhoI"
FT   misc_feature    108..113
FT                   /note="SIT unique StuI"
FT   misc_feature    112..117
FT                   /note="SIT XhoI"
FT   misc_feature    118..123
FT                   /note="SIT SalI"
FT   misc_feature    124..129
FT                   /note="SIT unique PstI"
FT   misc_feature    142..147
FT                   /note="SIT unique SphI"
XX
SQ   Sequence 147 BP; 33 A; 44 C; 40 G; 30 T; 0 other;
     gaattcggta cccgcccggg atcagatccg cggccgcata ggccactagt ggatctggat
     cctctagagt cgacctcgaa cgttaacgtt aacgtaacgt taactcgagg cctcgaggtc
     gacctgcagc caagctacgt tgcatgc
//