back Return to this vector's summary.
ID   PWE16      preliminary; circular DNA; SYN; 8800 BP.
XX
AC   IG0334; ATCC37524; U00003; X65279; M99569;
XX
DT   02-NOV-1992 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Vertebrate/E.coli cosmid vector pWE16 - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pWE2 from pCV107 & pGEM-2
RC   pWE4 from pCV108 & pGEM-2
RC   pWE8 from pWE4 & oligo
RC   pWE10 from pWE8
RC   pWE15 from pWE2 & pSV2-neo
RC   pWE16 from pWE4 & pSV2-dhfr
RA   Evans G.A., Wahl G.;
RT   "Cosmid vectors for genomic walking and rapid restriction mapping";
RL   Meth. Enzymol. 152:604-610(1987).
XX
CC   pWE15 (ATCC 37503) and pWE16 (ATCC 37524) differ only in the markers
CC   selectable in vertebrate cells. [1]
CC   Useful for constructing genomic libraries and chromosome walking and
CC   for gene transfer using dihydrofolate reductase as a selectable
CC   marker. [1]
CC   Medium is 1227 LB plus ampicillin.
CC   NM (pWE16)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (cosmid)
CC   SP (ATCC)
CC   HO (E.coli LE392)(E.coli)(mammal cell line)(vertebrate cells)
CC   CP ()
CC   FN (cloning cDNA)(mapping)
CC   SE ()
CC   PA (lambda)(pBR322)
CC   BR (pWE15)
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pJB8 5464bp
FT                   2. pSV2-neo 5729bp
FT                   -> pCV108 11193bp
FT                   1. pCV108 7700bp, lambda cos
FT                   2. pGEM-2 EcoRI-NotI-T3 prom-BamHI-T7 prom-NotI-EcoRI
FT                   \ 70bp
FT                   \ gaattcgcggccgcaattaaccctcactaaaggatccctatagtgagtcg
FT                   \ tattatgcggccgcgaattc, pGEM-2 11..11
FT                   -> pWE4 7800bp
FT                   1. pWE4 7800bp
FT                   2. pSV2-dhfr 1000bp, mouse dhfr gene
FT                   -> pWE16 8800bp"
FT   misc_binding    0..0
FT                   /note="MCS EcoRI-NotI-BamHI-NotI-EcoRI"
FT   misc_binding    0..0
FT                   /note="SIT EcoRI"
FT   misc_binding    0..0
FT                   /note="SIT NotI"
FT   promoter        0..0
FT                   /note="PRO bacteriophage T3"
FT   misc_binding    0..0
FT                   /note="SIT unique BamHI"
FT   promoter        complement(0..0)
FT                   /note="PRO bacteriophage T7"
FT   misc_binding    0..0
FT                   /note="SIT NotI"
FT   misc_binding    0..0
FT                   /note="SIT EcoRI"
FT   misc_binding    0..0
FT                   /note="SIT ClaI"
FT   misc_binding    0..0
FT                   /note="SIT HindIII"
FT   misc_binding    0..0
FT                   /note="SIT bacteriophage lambda cos region"
FT   misc_binding    0..0
FT                   /note="SIT SalI"
FT   rep_origin      0..0
FT                   /note="ORI SV40"
FT   promoter        complement(0..0)
FT                   /note="PRO SV40 early genes"
FT   CDS             0..0
FT                   /note="ANT E. coli neomycin phosphotransferase II gene
FT                   (NPTII); neomycin resistance gene (neo)"
FT   CDS             0..0
FT                   /note="ANT mammal G418 resistance gene (G418)"
FT   CDS             0..0
FT                   /note="ANT E. coli kanamycin resistance gene (kan)"
FT   CDS             0..0
FT                   /note="ANT E. coli methotrexate resistance gene (mtx)
FT                   (metraxin)"
FT   misc_binding    0..0
FT                   /note="SIT SfiI"
FT   misc_binding    0..0
FT                   /note="SIT HindIII"
FT   misc_binding    0..0
FT                   /note="SIT BglII"
FT   misc_binding    0..0
FT                   /note="SIT BssHII"
FT   misc_binding    0..0
FT                   /note="SIT SmaI"
FT   rep_origin      complement(0..0)
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             complement(1626..2486)
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
XX
SQ   Sequence 70 BP; 18 A; 19 C; 16 G; 17 T; 0 other;
     gaattcgcgg ccgcaattaa ccctcactaa aggatcccta tagtgagtcg tattatgcgg
     ccgcgaattc
//